콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

모든 문서 보기

EHU001761

Sigma-Aldrich

MISSION® esiRNA

targeting human LRRC8A

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GGACATTGTGTACCGCCTCTACATGCGGCAGACCATCATCAAGGTGATCAAGTTCATCCTCATCATCTGCTACACCGTCTACTACGTGCACAACATCAAGTTCGACGTGGACTGCACCGTGGACATTGAGAGCCTGACGGGCTACCGCACCTACCGCTGTGCCCACCCCCTGGCCACACTCTTCAAGATCCTGGCGTCCTTCTACATCAGCCTAGTCATCTTCTACGGCCTCATCTGCATGTATACACTGTGGTGGATGCTACGGCGCTCCCTCAAGAAGTACTCGTTTGAGTCGATCCGTGAGGAGAGCAGCTACAGCGACATCCCCGACGTCAAGAACGACTTCGCCTTCATGCTGCACCTCATTGACCAATACGACCCGCTCTACTCCAAGCGCTTCGCCGTCTTCCTGTCGGAGGTGAGTGAGAACAAGCTGCGGCAGCTGAACCTCAACAACGAGTGGACGCTGGACAAGCTCCGGCAGCGGCTCACCAAGAACGCGCAGGACAAGCTGGAGCTGCACCTGTTCATGCTCAGTGGCATCCCTGACACTGTGTTTGACCTGGTGGAGCT

Ensembl | 인체 수납 번호

ENSG00000136802

NCBI 수납 번호

NM_019594

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... LRRC8A(56262) , LRRC8A(56262)

관련 카테고리

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
VAV
CNU
DFU
ORT
DOR

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Chao Yang et al.
Human cell, 32(1), 41-50 (2018-11-15)
Chloride (Cl-), a primary anion in the extracellular fluid, plays an important role in a variety of physiological and pathological processes, such as cell apoptosis and proliferation. However, the information about Cl- in cancer cell apoptosis and chemoresistance is poorly
Tomoki Konishi et al.
The American journal of pathology, 189(10), 1973-1985 (2019-07-20)
The volume-regulated anion channel is composed of leucine-rich repeat-containing protein A (LRRC8A) and is activated by hypotonic conditions to implement the process of regulatory volume decrease. The role of LRRC8A in regulating genes related to progression of esophageal squamous cell
Atsushi Shiozaki et al.
International journal of oncology, 55(4), 905-914 (2019-08-23)
Although peritoneal lavage with distilled water performed after surgery prevents peritoneal seeding, cancer cells may avoid rupture under mild hypotonicity through regulatory volume decrease (RVD), which is the homeostatic regulation of ion and water transport. The aim of the present study
Unnur Arna Thorsteinsdottir et al.
Phytotherapy research : PTR, 30(1), 97-104 (2015-11-10)
We have tested the effect of protolichesterinic acid (PA) on the activity of the volume-sensitive release pathway for the organic osmolyte taurine (VSOAC) and the expression of the leucine-rich-repeat-channel 8A (LRRC8A) protein, which constitutes an essential VSOAC component. Exposing human
Andrea Milenkovic et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(20), E2630-E2639 (2015-05-06)
In response to cell swelling, volume-regulated anion channels (VRACs) participate in a process known as regulatory volume decrease (RVD). Only recently, first insight into the molecular identity of mammalian VRACs was obtained by the discovery of the leucine-rich repeats containing

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.