설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CGGGCTCAACATCACTACCTGTCATGATGTGCTCAATGAAACCCTGCTCGAAGGCTACTATGCCTACTACTTCTCAGCCTTCTCTGCTGTCTTCTTTTTTGTGCCGCTGATCATTTCCACGGTCTGTTATGTGTCTATCATTCGATGTCTTAGCTCTTCCGCAGTTGCCAACCGCAGCAAGAAGTCCCGGGCTTTGTTCCTGTCAGCTGCTGTTTTCTGCATCTTCATCATTTGCTTCGGACCCACAAACGTCCTCCTGATTGCGCATTACTCATTCCTTTCTCACACTTCCACCACAGAGGCTGCCTACTTTGCCTACCTCCTCTGTGTCTGTGTCAGCAGCATAAGCTGCTGCATCGACCCCCTAATTTACTATTACGCTTCCTCTGAGTGCCAGAGGTACGTCTACAGTATCTTATGCTGCAAAGAAAGTTCCGATCCCA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Omozuanvbo Aisiku et al.
Blood, 125(12), 1976-1985 (2015-01-15)
Protease-activated receptor-1 (PAR1) couples the coagulation cascade to platelet activation during myocardial infarction and to endothelial inflammation during sepsis. This receptor demonstrates marked signaling bias. Its activation by thrombin stimulates prothrombotic and proinflammatory signaling, whereas its activation by activated protein
Zhuang-Zhuang Tang et al.
Phytomedicine : international journal of phytotherapy and phytopharmacology, 78, 153314-153314 (2020-09-04)
Sarsasapogenin (Sar) shows good effects on diabetic nephropathy (DN) through inhibition of the NLRP3 inflammasome, yet the potential mechanism is not well known. This study was designed to explore the regulation of thrombin and/or its receptor protease-activated receptor 1 (PAR-1)
Clément d'Audigier et al.
Angiogenesis, 18(3), 347-359 (2015-06-01)
Endothelial colony forming cells (ECFC) represent a subpopulation of endothelial progenitor cells involved in endothelial repair. The activation of procoagulant mechanisms associated with the vascular wall's inflammatory responses to injury plays a crucial role in the induction and progression of
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.