Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EMU094441

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ptprj

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGTGGGTTTGCAGAGGAATATGAGGACCTGAAGCTGATTGGGATAAGTTTACCTAAATACACAGCTGAGATAGCCGAGAACAGAGGGAAGAACCGCTACAACAATGTTCTGCCCTATGATATTTCTCGAGTCAAACTTTCAGTCCAGACCCATTCGACAGATGACTACATCAATGCCAACTATATGCCTGGCTACCATTCCAAGAAAGATTTCATTGCCACACAAGGACCTTTACCCAACACTTTGAAAGATTTCTGGCGTATGGTTTGGGAGAAAAACGTATATGCCATTGTTATGTTGACCAAATGCGTGGAGCAGGGAAGGACCAAATGTGAGGAGTACTGGCCTTCCAAGCAGGCTCAGGACTACGGGGACATAACTGTGGCGATGACATCAGAAGTCGTTCTTCCAGAATGGACC

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Gregory C Sartor et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 35(45), 15062-15072 (2015-11-13)
Epigenetic processes that regulate histone acetylation play an essential role in behavioral and molecular responses to cocaine. To date, however, only a small fraction of the mechanisms involved in the addiction-associated acetylome have been investigated. Members of the bromodomain and
K Spring et al.
Oncogene, 34(44), 5536-5547 (2015-03-17)
DEP-1/PTPRJ is a receptor-like protein tyrosine phosphatase mainly known for its antiproliferative and tumor-suppressive functions. Many identified substrates are growth factor receptors, and DEP-1 is deleted and/or mutated in human cancers including that of the breast. However, DEP-1 was also
Xiaoling Luo et al.
OncoTargets and therapy, 8, 3159-3167 (2015-11-26)
Interaction between microRNA (miR-328) and PTPRJ (protein tyrosine phosphatase, receptor type, J) has been reported to be responsible for miR-328-dependent increase in epithelial cancer cell proliferation. However, the role of miR-328 and PTPRJ in hepatocellular carcinoma (HCC) remains unclear. The

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique