Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EMU088231

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Yap1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CACACTGGAAGGAGATGCAATGAACATAGAAGGGGAGGAGCTGATGCCCAGTCTGCAGGAAGCGCTGAGTTCCGAAATCTTGGACGTGGAGTCTGTGTTGGCTGCCACCAAGCTAGATAAAGAAAGCTTTCTCACGTGGTTATAGAGCTGCAGGGAGCCACTCTGAGTCTGTGAGGGATCCACAGAGCCTAAGATGTGCACGCCTGAAATTCAGATAAGTCAGTGGGGGTTCTCTGGCTAACACAGAAAACAGATGAACCAGTGTCCATCGTTGTTCCGCTTTTCTCTGCCCGTCGCTGCTCTTACGTTGGTTGCTGACCTCTTCACGGCCGGCTCTAAAGAACCCGAACCGCAGACAGATTCCTTTGTTAACTCTGCTATGATAACTACGTTCTCTGGGATTGCTGGGGGATGGCCTGCTGGATAATGGATGTTCTGCCTTTTGTCCGGTGGTCCTTTCACCATCACTTTAACTGAACACACAGACTGGGAACTGAATGCTCTAGAACATTGTTCAAGAGGTGGTTTCTTCAGCTGC

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Lise Lotte Christensen et al.
PloS one, 9(6), e96767-e96767 (2014-06-04)
MicroRNAs (miRNAs) play a critical role in many biological processes and are aberrantly expressed in human cancers. Particular miRNAs function either as tumor suppressors or oncogenes and appear to have diagnostic and prognostic significance. Although numerous miRNAs are dys-regulated in
Erica Lorenzetto et al.
Oncotarget, 5(9), 2608-2621 (2014-05-09)
The transcriptional coactivator YAP1 is a critical effector of the human Salvador-Warts-Hippo pathway. Literature data report apparently discrepant results on the carcinogenic role of YAP1, which acts either as oncogene or as tumor suppressor in different in vitro and in
Hyun-Jung Choi et al.
Nature communications, 6, 6943-6943 (2015-05-13)
Angiogenesis is regulated by the dynamic interaction between endothelial cells (ECs). Hippo-Yes-associated protein (YAP) signalling has emerged as a key pathway that controls organ size and tissue growth by mediating cell contact inhibition. However, the role of YAP in EC
David Fu et al.
Endocrine-related cancer, 21(2), 297-310 (2014-01-07)
The Hippo signaling pathway has been implicated as a conserved regulator of organ size in both Drosophila and mammals. Yes-associated protein (YAP), the central component of the Hippo signaling cascade, functions as an oncogene in several malignancies. Ovarian granulosa cell
C He et al.
Oncogene, 34(50), 6040-6054 (2015-03-24)
Mechanisms underlying ovarian cancer initiation and progression are unclear. Herein, we report that the Yes-associated protein (YAP), a major effector of the Hippo tumor suppressor pathway, interacts with ERBB signaling pathways to regulate the initiation and progression of ovarian cancer.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique