Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EMU086861

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hdac2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TATTATGGCCAGGGTCATCCCATGAAGCCTCATAGAATCCGGATGACTCATAACTTGCTGCTAAATTATGGTTTATACCGAAAAATGGAAATATATAGGCCTCATAAAGCCACTGCTGAAGAAATGACTAAATACCACAGCGATGAGTATATCAAGTTTCTACGATCAATAAGACCAGATAATATGTCTGAGTACAGTAAGCAGATGCAGAGATTTAACGTCGGAGAAGATTGTCCGGTGTTTGATGGACTCTTTGAGTTTTGTCAGCTCTCCACGGGTGGTTCAGTTGCTGGGGCTGTGAAATTAAACCGGCAACAAACTGATATGGCTGTCAATTGGGCTGGAGGACTACATCATGCCAAGAAGTCAGAAGCATCAGGGTTCTGCTATGTTAATGATATTGTGCTTGCCATCCTCGAATTACTTAAGTATCATCAGAGAGTCTTATATATTGACATAGACATCCACCATGGTGATGGTGTTGAGGAAGCTTTTTATACAACAGATCGCGTGATGAC

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Olga S Safronova et al.
Nucleic acids research, 42(14), 8954-8969 (2014-07-25)
Hypoxia is associated with a variety of physiological and pathological conditions and elicits specific transcriptional responses. The elongation competence of RNA Polymerase II is regulated by the positive transcription elongation factor b (P-TEFb)-dependent phosphorylation of Ser2 residues on its C-terminal
Chun-Xia Luo et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 34(40), 13535-13548 (2014-10-03)
Stroke is a major public health concern. The lack of effective therapies heightens the need for new therapeutic targets. Mammalian brain has the ability to rewire itself to restore lost functionalities. Promoting regenerative repair, including neurogenesis and dendritic remodeling, may

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique