Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EMU060801

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Stk11

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAGAGGCCAACGTCAAGAAGGAGATCCAGCTGCTGCGGCGGCTGCGGCATCGGAATGTGATCCAGCTTGTGGACGTGCTGTACAATGAGGAGAAGCAGAAGATGTATATGGTGATGGAGTACTGCGTATGTGGCATGCAGGAGATGCTGGACAGTGTGCCGGAGAAGCGCTTCCCTGTGTGCCAAGCTCATGGGTACTTCCGCCAGCTGATTGACGGCCTGGAATACCTACACAGCCAGGGCATTGTTCACAAGGACATCAAGCCGGGCAACCTGCTACTCACCACCAATGGCACACTCAAGATCTCCGACCTCGGTGTTGCCGAGGCCCTGCACCCTTTCGCTGTGGATGACACCTGCCGGACAAGCCAGGGCTCCCCGGCCTTCCAGCCTCCTGAGATTG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Fanny Dupuy et al.
Cancer & metabolism, 1(1), 18-18 (2013-11-28)
Germline and somatic mutations in STK11, the gene encoding the serine/threonine kinase LKB1, are strongly associated with tumorigenesis. While loss of LKB1 expression has been linked to breast cancer, the mechanistic role of LKB1 in regulating breast cancer development, metastasis
Ngai Na Co et al.
Cancer, 120(22), 3457-3468 (2014-07-22)
Liver kinase B1 (LKB1) is a serine/threonine kinase that functions as a tumor suppressor and regulates cell polarity, proliferation, and metabolism. Mutations in LKB1 are associated with Peutz-Jeghers syndrome as well as sporadic cervical and lung cancers. Although LKB1-null mice
Juan Li et al.
Journal of experimental & clinical cancer research : CR, 33, 70-70 (2014-09-03)
LKB1, also known as STK11, is a master kinase that serves as an energy metabolic sensor and is involved in cell polarity regulation. Recent studies have indicated that LKB1 is related to breast tumorigenesis and breast cancer progression. However, little
Kaisheng Mao et al.
Lung cancer (Amsterdam, Netherlands), 88(2), 131-138 (2015-03-15)
The tumor suppressor LKB1 has recently been shown to be involved in the regulation of microtubule dynamics, thus cancer cells with inactivated LKB1 may have developed a means to overcome dysregulated microtubule functions, making them intrinsically resistant to microtubule targeting
Shabnam Pooya et al.
Nature communications, 5, 4993-4993 (2014-09-27)
A prerequisite to myelination of peripheral axons by Schwann cells (SCs) is SC differentiation, and recent evidence indicates that reprogramming from a glycolytic to oxidative metabolism occurs during cellular differentiation. Whether this reprogramming is essential for SC differentiation, and the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique