Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EMU055771

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Aurkb

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCCAGAAGTTGGCTGAGAACAAGAGTCAGGGCTCCACTGCCTCGCAAGGATCCCAGAACAAGCAGCCTTTCACTATTGACAACTTTGAGATTGGGCGTCCTTTGGGCAAAGGCAAATTTGGAAACGTGTACTTGGCTCGGGAGAAGAAGAGCCGTTTCATCGTGGCACTCAAGATCCTCTTCAAGTCTCAGATTGAGAAGGAGGGGGTAGAGCACCAGCTTCGCCGAGAGATCGAAATCCAGGCGCACCTGAAACATCCCAACATCCTTCAACTCTACAACTACTTCTACGACCAGCAGAGGATCTACTTAATCCTGGAATACGCCCCTCGCGGGGAACTCTACAAGGAACTGCAGAAGAGTCGGACCTTCGATGAGCAGCGGACTGCCACGATCATGGAGGAACTGTCAGATGCCCTGACCTACTGCCACAAGAAGAAGGTAATTCACAGAGACATAAAGCCGGAGAACCTGCTGTTAGGTCTGCAGGGAG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Kazuharu Kai et al.
Molecular cancer therapeutics, 14(12), 2687-2699 (2015-10-08)
Currently, no targeted drug is available for triple-negative breast cancer (TNBC), an aggressive breast cancer that does not express estrogen receptor, progesterone receptor, or HER2. TNBC has high mitotic activity, and, because Aurora A and B mitotic kinases drive cell
Antonio Madejón et al.
Journal of hepatology, 63(2), 312-319 (2015-03-04)
Chronic hepatitis C is a leading cause of chronic liver disease, cirrhosis and hepatocellular carcinoma. DNA methylation and histone covalent modifications constitute crucial mechanisms of genomic instability in human disease, including liver fibrosis and hepatocellular carcinoma. The present work studies
Lijuan Zhu et al.
The Journal of biological chemistry, 290(45), 27053-27066 (2015-09-18)
Mitotic chromosome segregation is orchestrated by the dynamic interaction of spindle microtubules with the kinetochores. During chromosome alignment, kinetochore-bound microtubules undergo dynamic cycles between growth and shrinkage, leading to an oscillatory movement of chromosomes along the spindle axis. Although kinetochore
Aarthi Jayanthan et al.
PloS one, 9(7), e102741-e102741 (2014-07-23)
Leukemia is the most common pediatric malignancy, constituting more than 30% of all childhood cancers. Although cure rates have improved greatly, approximately one in five children relapse and poor survival rates post relapse remain a challenge. Given this, more effective

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique