Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EMU050451

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Suz12

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GATGGCTCCTATGCAGGAAATCCTCAGGATATACATCGCCAACCTGGATTTGCTTTTAGTCGAAATGGACCGGTAAAGAGAACACCTATCACACATATTCTTGTTTGCAGGCCAAAAAGAACAAAAGCAAGCATGTCGGAGTTTCTTGAATCTGAAGATGGAGAAGTGGAGCAGCAGAGAACATACAGCAGTGGCCACAATCGTCTCTATTTCCACAGTGATACCTGCTTACCTCTTCGGCCACAAGAAATGGAAGTAGATAGTGAAGATGAGAAAGATCCAGAATGGCTGAGAGAAAAAACCATTACTCAAATTGAAGAATTTTCTGATGTGAATGAAGGAGAGAAAGAAGTGATGAAGCTGTGGAACCTCCATGTCATGAAGCATGGATTTATTGCTGACAATCAAATGAATCATGCCTGTATGCTGTTTG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Weisi Liu et al.
The Journal of biological chemistry, 290(47), 28489-28501 (2015-10-08)
Our previous studies identified the oncogenic role of p21-activated kinase 1 (PAK1) in hepatocellular carcinoma (HCC) and renal cell carcinoma (RCC). Contrarily, PAK6 was found to predict a favorable prognosis in RCC patients. Nevertheless, the ambiguous tumor suppressive function of
Ming-de Huang et al.
Journal of hematology & oncology, 8, 50-50 (2015-05-15)
Hepatocellular carcinoma (HCC) is one of the leading causes of cancer-related death, especially in China. And the mechanism of its progression remains poorly understood. Growing evidence indicates that long non-coding RNAs (lncRNAs) are found to be dysregulated in many cancers
Xuefei Shi et al.
Molecular carcinogenesis, 54 Suppl 1, E1-E12 (2013-12-21)
In more recent years, long non-coding RNAs (lncRNAs) have been investigated as a new class of regulators of cellular processes, such as cell growth, apoptosis, and carcinogenesis. Although lncRNAs are dysregulated in numerous cancer types, limited data are available on
Michael Anthony Ruiz et al.
PloS one, 10(4), e0123987-e0123987 (2015-04-18)
Glucose-induced augmented vascular endothelial growth factor (VEGF) production is a key event in diabetic retinopathy. We have previously demonstrated that downregulation of miR-200b increases VEGF, mediating structural and functional changes in the retina in diabetes. However, mechanisms regulating miR-200b in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique