Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EMU043271

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rrm2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCACTGGGAAGCTCTGAAACCCGATGAGAGACATTTTATATCTCACGTTCTGGCTTTCTTTGCAGCGAGTGATGGCATAGTCAATGAGAACTTGGTGGAGCGATTTAGCCAAGAAGTTCAAGTTACAGAGGCCCGCTGTTTCTATGGCTTCCAAATTGCCATGGAAAACATACACTCTGAAATGTACAGTCTCCTTATTGACACTTACATTAAAGATCCCAAGGAAAGAGAATATCTCTTCAATGCTATTGAAACTATGCCTTGTGTGAAGAAGAAGGCTGACTGGGCCTTGCGCTGGATTGGGGACAAAGAGGCTACGTATGGAGAACGCGTTGTGGCCTTTGCCGCCGTAGAAGGAATCTTCTTTTCCGGTTCTTTTGCATCGATATTCTGGCTCAAGAAACGGGGGCTGATGCCGGGCCTTACATTTTCCAATGAGCTTATTAGCAGAGACGAGGGTTTACACTGTGACTTTGCCTGCCTGATGTTCAAGCACCTGGTACACAAGCCAGCGGAGCAGAGGGTCCGAGAGATAATCACCAACGCCG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wei Kang et al.
Oncology reports, 31(6), 2579-2586 (2014-04-24)
Ribonucleotide reductase M2 subunit (RRM2) is one of the two subunits of human ribonucleotide reductase which plays a critical role in tumor progression. The aim of the present study was to analyze its expression, clinical significance and biological functions in gastric
Zejun Fang et al.
Biochemical and biophysical research communications, 464(2), 407-415 (2015-06-21)
As the ribonucleotide reductase small subunit, the high expression of ribonucleotide reductase small subunit M2 (RRM2) induces cancer and contributes to tumor growth and invasion. In several colorectal cancer (CRC) cell lines, we found that the expression levels of RRM2
Nagireddy Putluri et al.
Neoplasia (New York, N.Y.), 16(5), 390-402 (2014-07-14)
Breast cancer (BCa) molecular subtypes include luminal A, luminal B, normal-like, HER-2-enriched, and basal-like tumors, among which luminal B and basal-like cancers are highly aggressive. Biochemical pathways associated with patient survival or treatment response in these more aggressive subtypes are
Kazuki Iwamoto et al.
International journal of oncology, 46(5), 1971-1977 (2015-03-05)
In our previous study, ribonucleotide reductase M2 (RRM2) was identified as a cancer-related gene commonly overexpressed in human oral squamous cell carcinoma (OSCC) cell lines. Herein, we attempted to determine whether targeting RRM2 may be a plausible therapeutic approach for
Rong Zhou et al.
Acta pharmacologica Sinica, 35(11), 1375-1384 (2014-09-30)
Ryanodine receptor 2 (RyR2) is a critical component of intracellular Ca(2+) signaling in vascular smooth muscle cells (VSMCs). The aim of this study was to investigate the role of RyR2 in abnormal vascular reactivity after hemorrhagic shock in rats. SD

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique