Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EMU036501

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tsc22d3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGTGGTTCTGCGGTGTAAGTGGCTCTGTCCTTAGGGTGGGCAGAGCCACATCTTGTTCTACCTAGTTCTTTCCAGTTTGTTTTTGGCTCCCCAAGCGTCATCTCATGTGGAGAACTTTACACCTAACATAGCTGGTGCCAAGAGATGTCCCAAGGACATGCCCATCTGGGTCCACTCCAGTGACAGACCCCTGACAAAGAGCAGGTCTCTGGAGACTAAGTTGCATGGGGCCTAGTAACACCAAGCCAGTGAGCCTGTCGTGTCACCGGGCCCTGGGGGCTCCCAGGGCCTGGGCAACTTAGTTACAGCTGACCAAGGAGAAAGTAGTTTTGAGATGTGATGCCAGTGTGCTCCAGAAAGTGTAAGGGGTCTGTTTTTCATTTCCATGGACATCTTCCACAGCTTCACCTGACAATGACTGTTCCTATGAAGAAGCCACTTGTGTTCTAAGCAGAAGCAACCTCTCTCTTCTTCTCTGTCTTTTCCAGGCAGG

Numéro d'accès Ensembl | souris

ENSMUSG00000031431

Numéro d'accès NCBI

NM_010286

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... TSC22D3(14605) , Tsc22d3(14605)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
XWR
AOR

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Nassima Redjimi et al.
Molecular cancer, 8, 83-83 (2009-10-10)
Little is known about the molecules that contribute to tumor progression of epithelial ovarian cancer (EOC), currently a leading cause of mortality from gynecological malignancies. Glucocorticoid-Induced Leucine Zipper (GILZ), an intracellular protein widely expressed in immune tissues, has been reported
Jeffrey S Futterleib et al.
Transfusion and apheresis science : official journal of the World Apheresis Association : official journal of the European Society for Haemapheresis, 50(3), 379-387 (2013-11-13)
Extracorporeal photochemotherapy (ECP) is a widely used method for either immunization against cutaneous T cell lymphoma or immunosuppression of graft-versus-host disease and organ transplant rejection (OTR). Leukapheresed blood is routed through a chamber, in which 8-methoxypsoralen is activated by ultraviolet
Huapeng Fan et al.
Arthritis & rheumatology (Hoboken, N.J.), 66(8), 2059-2070 (2014-05-02)
Glucocorticoids remain a mainstay in the treatment of rheumatoid arthritis (RA). Dose-dependent adverse effects highlight the need for therapies that regulate glucocorticoid sensitivity to enable dosage reduction. Macrophage migration inhibitory factor (MIF) is a proinflammatory protein that has been implicated

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique