Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EMU025381

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Fos

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGCAGTCAGAGAAGGCAAGGCAGCCGGCATCCAGACGTGCCACTGCCCGAGCTGGTGCATTACAGAGAGGAGAAACACGTCTTCCCTCGAAGGTTCCCGTCGACCTAGGGAGGACCTTACCTGTTCGTGAAACACACCAGGCTGTGGGCCTCAAGGACTTGCAAGCATCCACATCTGGCCTCCAGTCCTCACCTCTTCCAGAGATGTAGCAAAAACAAAACAAAACAAAACAAAAAACCGCATGGAGTGTGTTGTTCCTAGTGACACCTGAGAGCTGGTAGTTAGTAGAGCATGTGAGTCAAGGCCTGGTCTGTGTCTCTTTTCTCTTTCTCCTTAGTTTTCTCATAGCACTAACTAATCTGTTGGGTTCATTATTGGAATTAACCTGGTGCTGGATTGTATCTAGTGCAGCTGATTTTAACAATACCTACTGTGTTCCTGGCAATAGCGTGTT

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ji Hye Kim et al.
Stem cells and development, 23(12), 1364-1376 (2014-02-15)
Although adipose-derived stem cells (ASCs) show promise for cell therapy, there is a tremendous need for developing ASC activators. In the present study, we investigated whether or not vitamin C increases the survival, proliferation, and hair-regenerative potential of ASCs. In
Ryeojin Ko et al.
Nature communications, 6, 6765-6765 (2015-04-02)
TRAF6 is critical for the production of inflammatory cytokines in various TLR-mediated signalling pathways. However, it is poorly understood how TRAF6 regulates TLR3 responses. Here we demonstrate that GSK3β interacts with TRAF6 and positively regulates the TLR3-mediated signalling. Suppression of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique