Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU151801

Sigma-Aldrich

MISSION® esiRNA

targeting human KLF4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGAAGGATCTCGGCCAATTTGGGGTTTTGGGTTTTGGCTTCGTTTCTTCTCTTCGTTGACTTTGGGGTTCAGGTGCCCCAGCTGCTTCGGGCTGCCGAGGACCTTCTGGGCCCCCACATTAATGAGGCAGCCACCTGGCGAGTCTGACATGGCTGTCAGCGACGCGCTGCTCCCATCTTTCTCCACGTTCGCGTCTGGCCCGGCGGGAAGGGAGAAGACACTGCGTCAAGCAGGTGCCCCGAATAACCGCTGGCGGGAGGAGCTCTCCCACATGAAGCGACTTCCCCCAGTGCTTCCCGGCCGCCCCTATGACCTGGCGGCGGCGACCGTGGCCACAGACCTGGAGAGCGGCGGAGCCGGTGCGGCTTGCGGCGGTAGCAACCTGGCGCCCCTACCTCGGAGAGAGACC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Bing Li et al.
Human gene therapy, 30(3), 339-351 (2018-09-13)
Kallistatin (KS) has been recognized as a plasma protein with anti-inflammatory functions. Macrophages are the primary inflammatory cells in atherosclerotic plaques. However, it is unknown whether KS plays a role in macrophage development and the pathogenesis of atherosclerosis. This study
Hong Lok Lung et al.
Scientific reports, 9(1), 12064-12064 (2019-08-21)
We and others have previously shown that the canonical nuclear factor kappa-B (NF-κB) pathway is essential to nasopharyngeal carcinoma (NPC) tumor development and angiogenesis, suggesting that the NF-κB pathway, including its upstream modulators and downstream effectors, are potential therapeutic targets
Guodong Tang et al.
Oncotarget, 7(49), 81757-81767 (2016-11-12)
In this study, our findings indicated that FOXO1 expression frequently decreased in glioma tissues and cells. FOXO1 expression decrease correlated with glioma progression and predicted a worse overall survival of glioma patients. Restored FOXO1 expression inhibited glioma cells invasion and
Scott Bell et al.
American journal of human genetics, 104(5), 815-834 (2019-04-30)
We identified individuals with variations in ACTL6B, a component of the chromatin remodeling machinery including the BAF complex. Ten individuals harbored bi-allelic mutations and presented with global developmental delay, epileptic encephalopathy, and spasticity, and ten individuals with de novo heterozygous
Maisa C Takenaka et al.
Nature neuroscience, 22(5), 729-740 (2019-04-10)
Tumor-associated macrophages (TAMs) play an important role in the immune response to cancer, but the mechanisms by which the tumor microenvironment controls TAMs and T cell immunity are not completely understood. Here we report that kynurenine produced by glioblastoma cells

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique