Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU147251

Sigma-Aldrich

MISSION® esiRNA

targeting human EIF5A2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATGGTCATGCCAAGGTTCACCTTGTTGGAATTGATATTTTCACGGGCAAAAAATATGAAGATATTTGTCCTTCTACTCACAACATGGATGTTCCAAATATTAAGAGAAATGATTATCAACTGATATGCATTCAAGATGGTTACCTTTCCCTGCTGACAGAAACTGGTGAAGTTCGTGAGGATCTTAAACTGCCAGAAGGTGAACTAGGCAAAGAAATAGAGGGAAAATACAATGCAGGTGAAGATGTACAGGTGTCTGTCATGTGTGCAATGAGTGAAGAATATGCTGTAGCCATAAAACCCTGCAAATAAACGGAAACATCAGGCATGAACACTGTTTATGTCTGAATCAACTGCAGATCTAATTTGGTTCTAAGTTGTCACCAAAGCTATAGCCTTCATAAGCAACCTCATTTCTTTTTTTAATTGTTTTCAGATTGTGCTGGGTTAGTTTTGCA

Numéro d'accès Ensembl | humain

ENSG00000163577

Numéro d'accès NCBI

NM_020390

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... EIF5A2(56648) , EIF5A2(56648)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
QCS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ying Bao et al.
International journal of biological sciences, 16(5), 827-837 (2020-02-20)
We investigated the role of microRNA (miR)-9 in modulating chemoresistance in hepatocellular carcinoma (HCC) cells. MiR-9 was overexpressed or knocked down in HCC cell lines. Cell viability, cell proliferation, the expression of EIF5A2 and the epithelial-mesenchymal transition (EMT)-related proteins were
Xiulong Zhong et al.
Bioengineered, 11(1), 619-627 (2020-06-12)
Overexpression of eukaryotic initiation factor- 5A2 (eIF5A2) has been implicated in promoting tumor cell migration and invasion in many cancers. However, whether eIF5A2 could be as the target for prostate cancer (PCa) treatment is still unknown. In this study, small
Yu Liu et al.
Breast cancer (Tokyo, Japan), 22(6), 602-607 (2014-03-19)
The eIF5A2 gene (encoding the eukaryotic initiation factor 5A2) located at 3q26 is a putative oncogene that is overexpressed in colon and rectal carcinomas, lung cancer and hepatocellular carcinoma. EIF5A2 overexpression correlates significantly with tumor metastasis and is an adverse

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique