Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU144891

Sigma-Aldrich

MISSION® esiRNA

targeting human EFNB2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGGGGTGTTTTGATGGTTTTATGCAGAACTGCGATTTCCAAATCGATAGTTTTAGAGCCTATCTATTGGAATTCCTCGAACTCCAAATTTCTACCTGGACAAGGACTGGTACTATACCCACAGATAGGAGACAAATTGGATATTATTTGCCCCAAAGTGGACTCTAAAACTGTTGGCCAGTATGAATATTATAAAGTTTATATGGTTGATAAAGACCAAGCAGACAGATGCACTATTAAGAAGGAAAATACCCCTCTCCTCAACTGTGCCAAACCAGACCAAGATATCAAATTCACCATCAAGTTTCAAGAATTCAGCCCTAACCTCTGGGGTCTAGAATTTCAGAAGAACAAAGATTATTACATTATATCTACATCAAATGGGTCTTTGGAGGGCCTGGATAACCAGGAGGGAGGGGTGTGCCAGACAAGAGCCATGAAGATCCTCATGAAAGTTGGACAAGATGCAAGTTCTGCTGG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Maha Coucha et al.
PloS one, 14(1), e0210523-e0210523 (2019-01-09)
We have previously shown that diabetes causes dysfunctional cerebral neovascularization that increases the risk for cerebrovascular disorders such as stroke and cognitive impairment. Pericytes (PCs) play a pivotal role in the angiogenic process through their interaction with the endothelial cells
Feng Zhu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 125, 109972-109972 (2020-02-10)
Ephrin-2 (EFNB2) is expressed at abnormally high levels in some neoplasms, such as squamous cell carcinoma of the head and neck and colorectal cancer. Its overexpression is associated with the malignant progression of tumors. However, the expression of EFNB2 in
Shilpa Bhatia et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 24(18), 4539-4550 (2018-06-01)
Purpose: The clinical success of targeted therapies such as cetuximab and radiotherapy (RT) is hampered by the low response rates and development of therapeutic resistance. In the current study, we investigated the involvement of EphB4-ephrin-B2 protumorigenic signaling in mediating resistance
Eri Sasabe et al.
PloS one, 12(11), e0188965-e0188965 (2017-12-01)
Oral squamous cell carcinoma (OSCC) is a common malignant tumor of the head and neck and frequently metastasizes to cervical lymph nodes. Aggressive local invasion and metastasis of OSCC are significant factors for poor prognosis. In this study, we investigated
Yan Hu et al.
Neuroscience bulletin, 30(3), 425-432 (2014-01-31)
Postmitotic neurons in the neocortex migrate to appropriate positions and form layered structures of nascent cortex during brain development. The migration of these neurons requires precise control and coordination of a large number of molecules such as axon guidance cues.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique