Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU123791

Sigma-Aldrich

MISSION® esiRNA

targeting human PRKDC

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTTCGACTTGCGTGTGATGTTGATCAGGTGACAAGGCAACTGTATGAGCCACTAGTTATGCAGCTGATTCACTGGTTCACTAACAACAAGAAATTTGAAAGTCAGGATACTGTTGCCTTACTAGAAGCTATATTGGATGGAATTGTGGACCCTGTTGACAGTACTTTAAGAGATTTTTGTGGTCGGTGTATTCGAGAATTCCTTAAATGGTCCATTAAGCAAATAACACCACAGCAGCAGGAGAAGAGTCCAGTAAACACCAAATCGCTTTTCAAGCGACTTTATAGCCTTGCGCTTCACCCCAATGCTTTCAAGAGGCTGGGAGCATCACTTGCCTTTAATAATATCTACAGGGAATTCAGGGAAGAAGAGTCTCTGGTGGAACAGTTTGTGTTTGAAGCCTTGGTGATATACATGGAGAGTCTGGCCTTAGCACATGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Bo Wang et al.
Cell cycle (Georgetown, Tex.), 18(21), 2876-2892 (2019-09-17)
Glioblastoma is the most aggressive brain tumor. Although miR-141 has been demonstrated to primarily function as a tumor suppressor in numerous malignancies, including glioblastoma, the mechanisms involved remain poorly understood. Here, it is shown that miR-141 is downregulated in glioblastoma
Shuai Li et al.
The FEBS journal, 286(12), 2341-2354 (2019-03-27)
Synthetic biology employs engineering principles to redesign biological systems for biomedical or industrial purposes. Innovation and application of original biological parts for genetic circuit construction will significantly facilitate and expedite the development of synthetic biology. Here, we built two- or
Sonia Paget et al.
Oncotarget, 8(2), 2916-2935 (2016-12-10)
The tumor suppressor gene HIC1 (Hypermethylated In Cancer 1) encodes a transcriptional repressor mediating the p53-dependent apoptotic response to irreparable DNA double-strand breaks (DSBs) through direct transcriptional repression of SIRT1. HIC1 is also essential for DSB repair as silencing of
E Dickreuter et al.
Oncogene, 35(11), 1353-1362 (2015-06-16)
β1 Integrin-mediated cell-extracellular matrix interactions allow cancer cell survival and confer therapy resistance. It was shown that inhibition of β1 integrins sensitizes cells to radiotherapy. Here, we examined the impact of β1 integrin targeting on the repair of radiation-induced DNA
Lin Jia et al.
The Journal of pathology, 243(2), 255-266 (2017-08-05)
Endostatin was discovered as an endogenous angiogenesis inhibitor with broad-spectrum antitumour activities. Although clinical efficacy was observed when endostatin was combined with standard chemotherapy for non-small cell lung cancer (NSCLC), as well as other cancer types, the specific mechanisms underlying

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique