Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU123061

Sigma-Aldrich

MISSION® esiRNA

targeting human AFDN

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCTGGGCCTGAGCTGATACTACCTGCAAGCATTGAATTCAGGGAAAGTTCTGAAGATTCATTTTTGTCTGCCATTATAAATTATACTAATAGCTCTACAGTCCACTTTAAGTTGTCCCCTACATATGTATTATATATGGCATGCCGGTATGTATTGTCCAACCAGTACAGACCTGACATCAGCCCTACAGAGCGCACACATAAAGTCATTGCAGTCGTCAACAAGATGGTGAGCATGATGGAGGGTGTCATCCAGAAACAGAAGAATATTGCAGGGGCACTTGCCTTCTGGATGGCAAATGCATCTGAACTTCTCAACTTCATTAAGCAAGACCGAGACCTTAGTCGGATCACACTGGATGCTCAAGATGTTTTAGCACATTTGGTTCAAATGGCATTTAAATACTTGGTTCACTGTCTTCAATCAGAACTTAATAATTACATGCCAGCCTTTCTAGATG

Numéro d'accès Ensembl | humain

ENSG00000130396

Numéro d'accès NCBI

NM_001040000

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... AFDN(4301) , MLLT4(4301)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Paul Ugalde-Silva et al.
MicrobiologyOpen, 8(12), e931-e931 (2019-10-01)
Enteropathogenic Escherichia coli (EPEC) infection causes a histopathological lesion including recruitment of F-actin beneath the attached bacteria and formation of actin-rich pedestal-like structures. Another important target of EPEC is the tight junction (TJ), and EspF induces displacement of TJ proteins
Haruko Tsurumi et al.
Laboratory investigation; a journal of technical methods and pathology, 96(1), 49-59 (2015-11-17)
In kidney glomeruli, mesangial cells provide structural support to counteract for expansile forces caused by pressure gradients and to regulate the blood flow. Glomerular injury results in proliferation and aberrant migration of mesangial cells, which is the pathological characteristic of
Takuro Yamamoto et al.
BMC cancer, 15, 275-275 (2015-04-17)
AF-6/afadin plays an important role in the formation of adherence junctions. In breast and colon cancer, loss of AF-6/afadin induces cell migration and cell invasion. We aimed to elucidate the role of AF-6/afadin in human endometrial cancer. Morphology and AF-6/afadin

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique