Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU120261

Sigma-Aldrich

MISSION® esiRNA

targeting human CRTC2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGCGAGATCCTCGAAGAATGGTGTCCCCACTTCGCCGATACACCCGCCACATATCCTTCACAGGGGACTTGGGAGTCTCTCCCTATAGTCCTGCCTACTTATCTCCTCCCCCAGAGTCTAGCTGGCGAAGGACGATGGCCTGGGGCAATTTCCCTGCAGAGAAGGGGCAGTTGTTTCGACTACCATCTGCACTTAACAGGACAAGCTCTGACTCTGCCCTTCATACAAGTGTGATGAACCCCAGTCCCCAGGATACCTACCCAGGCCCCACACCTCCCAGCATCCTGCCCAGCCGACGTGGGGGTATTCTGGATGGTGAAATGGACCCCAAAGTACCTGCTATTGAGGAGAACTTGCTAGATGACAAGCATTTGCTGAAGCCATGGGATGCTAAGAAGCTATCCTCATCCTCTTCCCGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CRTC2(200186)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xiao Zhi et al.
Liver transplantation : official publication of the American Association for the Study of Liver Diseases and the International Liver Transplantation Society, 23(9), 1186-1198 (2017-06-08)
Despite its rarity (1%-2%), acute graft-versus-host disease after liver transplantation (LT-aGVHD) has a high mortality rate (85%). A gradual decrease in regulatory T cells (Tregs) correlates with disease progression in a rat LT-GVHD model, and treatments which increase Tregs exert
Laura Rodón et al.
Science advances, 5(7), eaaw6455-eaaw6455 (2019-07-30)
The LKB1 tumor suppressor is often mutationally inactivated in non-small cell lung cancer (NSCLC). LKB1 phosphorylates and activates members of the AMPK family of Ser/Thr kinases. Within this family, the salt-inducible kinases (SIKs) modulate gene expression in part via the
Ali Rastegari et al.
Drug delivery and translational research, 9(3), 694-706 (2019-03-03)
Diabetes mellitus is a chronic metabolic disorder characterized by insulin deficiency and impaired glucose metabolism. Overexpression of cAMP response element binding protein (CREB)-regulated transcriptional coactivator 2 (CRTC2) plays an important role in high gluconeogenesis in patients with diabetes type II.
Ping Li et al.
Journal of agricultural and food chemistry, 67(37), 10513-10520 (2019-09-03)
Amino acids can stimulate milk fat synthesis, but the underlying molecular mechanism is still largely unknown. In this study, we studied the regulatory role and corresponding molecular mechanism of cAMP response element-binding protein-regulated transcription coactivator 2 (CRTC2) in amino acid-induced

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique