Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU116291

Sigma-Aldrich

MISSION® esiRNA

targeting human LGALS9

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGTGCTCAGAGGTTCCACATCAACCTGTGCTCTGGGAACCACATCGCCTTCCACCTGAACCCCCGTTTTGATGAGAATGCTGTGGTCCGCAACACCCAGATCGACAACTCCTGGGGGTCTGAGGAGCGAAGTCTGCCCCGAAAAATGCCCTTCGTCCGTGGCCAGAGCTTCTCAGTGTGGATCTTGTGTGAAGCTCACTGCCTCAAGGTGGCCGTGGATGGTCAGCACCTGTTTGAATACTACCATCGCCTGAGGAACCTGCCCACCATCAACAGACTGGAAGTGGGGGGCGACATCCAGCTGACCCATGTGCAGACATAGGCGGCTTCCTGGCCCTGGGGCCGGGGGCTGGGGTGTGGGGCAGTCTGGGTCCTCTCATCATCC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Katrin Schaefer et al.
Glycobiology, 27(9), 878-887 (2017-08-16)
Changes in the T cell surface redox environment regulate critical cell functions, such as cell migration, viral entry and cytokine production. Cell surface protein disulfide isomerase (PDI) contributes to the regulation of T cell surface redox status. Cell surface PDI
Tomokazu Nunoue et al.
Scientific reports, 11(1), 5991-5991 (2021-03-18)
The adipose tissue is regarded as an endocrine organ and secretes bioactive adipokines modulating chronic inflammation and oxidative stress in obesity. Gal-9 is secreted out upon cell injuries, interacts with T-cell immunoglobulin-3 (Tim-3) and induces apoptosis in activated Th1 cells.
Ran Lv et al.
Molecular medicine reports, 16(6), 9111-9119 (2017-10-11)
Generally considered as a potent pro‑inflammatory signal, β‑galactosidelectin suppresses T cell receptor activation, can both promote and inhibit integrin‑mediated adhesion and is required in nuclear pre‑mRNA splicing. Galectin‑9 (Gal‑9), a member of β‑galactoside lectin, is involved many processes of T cell‑mediated
Akira Nishio et al.
Hepatology (Baltimore, Md.), 65(1), 18-31 (2016-09-20)
Natural killer (NK) cell activation is associated with both liver injury and persistent infection in chronic hepatitis C (CHC); however, the detailed mechanism of this activation has not yet been fully elucidated. Because galectin-9 (Gal-9) has been reported to be
Wenxi Zhou et al.
Biomaterials, 268, 120546-120546 (2020-12-01)
Immunotherapy has gained increasing focus in treating pancreatic ductal adenocarcinoma (PDAC), since conventional therapies like chemotherapy could not provide satisfactory improvement in overall survival outcome of PDAC patients. However, it is still not the game changing solution due to the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique