Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU114221

Sigma-Aldrich

MISSION® esiRNA

targeting human YY1AP1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AAGACCAAACAGCTGCCAGTCCTAGGAAAATGCTGTGAAGAGATCCAGCCACATCAGTGGAAGCCACCTATAGAGAGAGAAGAACACCGGCTCCCATTCTGGTTAAAGGCCAGTCTGCCATCCATCCAGGAAGAACTGCGGCACATGGCTGATGGTGCTAGAGAGGTAGGAAATATGACTGGAACCACTGAGATCAACTCAGATCAAGGCCTAGAAAAAGACAACTCAGAGTTGGGGAGTGAAACTCGGTACCCACTGCTATTGCCTAAGGGTGTAGTCCTGAAACTGAAGCCAGTTGCCGACCGTTTCCCCAAGAAGGCTTGGAGACAGAAGCGTTCATCAGTCCTGAAACCCCTCCTTATCCAACCCAGCCCCTCTCTCCAGCCCAGCTTCAACCCTGGGAAAACAC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hyun-Jung Choi et al.
Nature communications, 6, 6943-6943 (2015-05-13)
Angiogenesis is regulated by the dynamic interaction between endothelial cells (ECs). Hippo-Yes-associated protein (YAP) signalling has emerged as a key pathway that controls organ size and tissue growth by mediating cell contact inhibition. However, the role of YAP in EC
David Fu et al.
Endocrine-related cancer, 21(2), 297-310 (2014-01-07)
The Hippo signaling pathway has been implicated as a conserved regulator of organ size in both Drosophila and mammals. Yes-associated protein (YAP), the central component of the Hippo signaling cascade, functions as an oncogene in several malignancies. Ovarian granulosa cell
C He et al.
Oncogene, 34(50), 6040-6054 (2015-03-24)
Mechanisms underlying ovarian cancer initiation and progression are unclear. Herein, we report that the Yes-associated protein (YAP), a major effector of the Hippo tumor suppressor pathway, interacts with ERBB signaling pathways to regulate the initiation and progression of ovarian cancer.
Upal Basu-Roy et al.
Nature communications, 6, 6411-6411 (2015-04-04)
The repressive Hippo pathway has a profound tumour suppressive role in cancer by restraining the growth-promoting function of the transcriptional coactivator, YAP. We previously showed that the stem cell transcription factor Sox2 maintains cancer stem cells (CSCs) in osteosarcomas. We
Ute Schütte et al.
Translational oncology, 7(2), 309-321 (2014-06-11)
Recent work has identified dysfunctional Hippo signaling to be involved in maintenance and progression of various human cancers, although data on clear cell renal cell carcinoma (ccRCC) have been limited. Here, we provide evidence implicating aberrant Hippo signaling in ccRCC

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique