Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU108071

Sigma-Aldrich

MISSION® esiRNA

targeting human SCD

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GATCATTGCCAACACAATGGCATTCCAGAATGATGTCTATGAATGGGCTCGTGACCACCGTGCCCACCACAAGTTTTCAGAAACACATGCTGATCCTCATAATTCCCGACGTGGCTTTTTCTTCTCTCACGTGGGTTGGCTGCTTGTGCGCAAACACCCAGCTGTCAAAGAGAAGGGGAGTACGCTAGACTTGTCTGACCTAGAAGCTGAGAAACTGGTGATGTTCCAGAGGAGGTACTACAAACCTGGCTTGCTGATGATGTGCTTCATCCTGCCCACGCTTGTGCCCTGGTATTTCTGGGGTGAAACTTTTCAAAACAGTGTGTTCGTTGCCACTTTCTTGCGATATGCTGTGGTGCTTAATGCCACCTGGCTGGTGAACAGTGCTGCCCACCTCTTCGGATATCGTCCTTATGACAAGAACATTAGCCCCCGGGAGAATATCCTGGTTTCACTTGGAGCTGTGGGTGAGGGCTTCCACAACTACC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Lei Li et al.
PloS one, 8(9), e75104-e75104 (2013-09-27)
Increased de novo lipogenesis is one of the major metabolic events in cancer. In human hepatocellular carcinoma (HCC), de novo lipogenesis has been found to be increased and associated with the activation of AKT/mTOR signaling. In mice, overexpression of an
Mohamed Amine Lounis et al.
Cancers, 12(11) (2020-11-15)
De novo lipogenesis (DNL) is now considered as a hallmark of cancer. The overexpression of key enzymes of DNL is characteristic of both primary and advanced disease and may play an important role in resistance to therapies. Here, we showed
Dawei Yao et al.
Journal of cellular physiology, 232(3), 635-649 (2016-06-25)
Stearoyl-CoA desaturase 1 (SCD1) is a key enzyme for the synthesis of the monounsaturated fatty acids (MUFA) palmitoleic acid and oleic acid. In non-ruminant species, SCD1 expression is known to be tightly regulated by a variety of transcription factors. Although
Yurena Vivas-García et al.
Molecular cell, 77(1), 120-137 (2019-11-18)
Phenotypic and metabolic heterogeneity within tumors is a major barrier to effective cancer therapy. How metabolism is implicated in specific phenotypes and whether lineage-restricted mechanisms control key metabolic vulnerabilities remain poorly understood. In melanoma, downregulation of the lineage addiction oncogene
Vishalakshi Nanjappa et al.
Cancer biology & therapy, 16(11), 1593-1603 (2015-09-24)
Chewing tobacco is a common practice in certain socio-economic sections of southern Asia, particularly in the Indian subcontinent and has been well associated with head and neck squamous cell carcinoma. The molecular mechanisms of chewing tobacco which leads to malignancy

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique