Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU104911

Sigma-Aldrich

MISSION® esiRNA

targeting human PDZK1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCCTATGAGAAGGTGGTGGATAGAATCCAGAGCAGTGGGAAGAATGTCACACTTCTAGTCTGTGGAAAGAAGGCCTATGATTATTTCCAAGCTAAGAAAATCCCTATTGTTTCCTCCCTGGCTGATCCACTTGACACCCCTCCAGATTCTAAAGAAGGAATAGTGGTGGAGTCAAACCATGACTCGCACATGGCAAAAGAACGGGCCCACAGTACAGCCTCACATTCTTCTTCCAATTCTGAAGATACAGAGATGTGATGAAAACAAGTAATAGCTTTGGCTGTTTATTTGATAGCTGTTTCTGGGTATTTAATAGGAATCCTTTCTCAAGGAATGAGTTGTGACCTGTTTACTGTCTCTTTAGAAGAAAAACTCCACTGGAAACCATTCACCATGTGTGATTGTCTTCTGTTATCATTTGTCTTACAGGCGGCTATTGC

Numéro d'accès Ensembl | humain

ENSG00000174827

Numéro d'accès NCBI

NM_002614

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PDZK1(5174) , PDZK1(5174)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
MTU

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yi Shao et al.
Oncology letters, 15(5), 6655-6665 (2018-04-05)
Patients with non-small-cell lung cancer (NSCLC) with sensitive epidermal growth factor receptor (EGFR) mutations generally react well to tyrosine kinase inhibitors (TKIs). However acquired resistance eventually occurs. Several mechanisms contribute to the resistance including T790M mutation, c-Met amplification and PIK3CA
Chunjuan Zhao et al.
Cancer letters, 453, 107-121 (2019-04-02)
Phosphorylation of PTEN plays an important role in carcinogenesis and progression of gastric cancer. However, the underlying mechanism of PTEN phosphorylation regulation remains largely elusive. In the present study, PDZK1 was identified as a novel binding protein of PTEN by
Ben J Wu et al.
International journal of cardiology, 199, 204-212 (2015-07-24)
High density lipoprotein (HDL) infusions increase new blood vessel formation (angiogenesis) in rodents with ischemic injury. This study asks if increasing HDL levels by inhibiting cholesteryl ester transfer protein (CETP) activity increases angiogenesis in New Zealand White (NZW) rabbits with

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique