Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU091841

Sigma-Aldrich

MISSION® esiRNA

targeting human INSR

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AAGTGCATCCCTGAGTGTCCCTCCGGGTACACGATGAATTCCAGCAACTTGCTGTGCACCCCATGCCTGGGTCCCTGTCCCAAGGTGTGCCACCTCCTAGAAGGCGAGAAGACCATCGACTCGGTGACGTCTGCCCAGGAGCTCCGAGGATGCACCGTCATCAACGGGAGTCTGATCATCAACATTCGAGGAGGCAACAATCTGGCAGCTGAGCTAGAAGCCAACCTCGGCCTCATTGAAGAAATTTCAGGGTATCTAAAAATCCGCCGATCCTACGCTCTGGTGTCACTTTCCTTCTTCCGGAAGTTACGTCTGATTCGAGGAGAGACCTTGGAAATTGGGAACTACTCCTTCTATGCCTTGGACAACCAGAACCTAAGGCAGCTCTGGGACTGGAGCAAACACAACCTCACCATCACTCAGGG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zheqi Li et al.
Endocrinology, 159(1), 285-296 (2017-10-14)
Increased evidence suggests that somatic mutations in the ligand-binding domain of estrogen receptor [ER (ERα/ESR1)] are critical mediators of endocrine-resistant breast cancer progression. Insulinlike growth factor-1 (IGF1) is an essential regulator of breast development and tumorigenesis and also has a
Phoebe L Sarkar et al.
Frontiers in endocrinology, 10, 481-481 (2019-08-06)
Androgen deprivation therapy (ADT) is the standard treatment for advanced prostate cancer (PCa), yet many patients relapse with lethal metastatic disease. With this loss of androgens, increased cell plasticity has been observed as an adaptive response to ADT. This includes
Sandip Mukherjee et al.
PloS one, 12(1), e0169809-e0169809 (2017-01-11)
Dramatic increase of diabetes over the globe is in tandem with the increase in insulin requirement. This is because destruction and dysfunction of pancreatic β-cells are of common occurrence in both Type1 diabetes and Type2 diabetes, and insulin injection becomes
Oscar Escribano et al.
Molecular and cellular endocrinology, 409, 82-91 (2015-03-24)
The main compensatory response to insulin resistance is the pancreatic beta cell hyperplasia to account for increased insulin secretion. In fact, in a previous work we proposed a liver-pancreas endocrine axis with IGF-I (insulin-like growth factor type I) secreted by
Shingo Ito et al.
Neurochemistry international, 101, 22-29 (2016-11-05)
We have previously shown in SH-SY5Y human neuroblastoma cells that the expressions of basal (75 kDa) and high molecular weight (HMW; 85 kDa) isoforms of the p75 neurotrophic receptor (p75NTR) are stimulated by amyloid-β peptide1-42 oligomers (AβOs) via the insulin-like growth factor-1

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique