Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU077321

Sigma-Aldrich

MISSION® esiRNA

targeting human PTK2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAATCCCACACATCTTGCTGACTTCACTCAAGTGCAAACCATTCAGTATTCAAACAGTGAAGACAAGGACAGAAAAGGAATGCTACAACTAAAAATAGCAGGTGCACCCGAGCCTCTGACAGTGACGGCACCATCCCTAACCATTGCGGAGAATATGGCTGACCTAATAGATGGGTACTGCCGGCTGGTGAATGGAACCTCGCAGTCATTTATCATCAGACCTCAGAAAGAAGGTGAACGGGCTTTGCCATCAATACCAAAGTTGGCCAACAGCGAAAAGCAAGGCATGCGGACACACGCCGTCTCTGTGTCAGAAACAGATGATTATGCTGAGATTATAGATGAAGAAGATACTTACACCATGCCCTCAACCAGGGATTATGAGATTCAAAGAGAAAGAATAGAACTTGGACGATGTATTGGAGAAGGCCAATTTGGAGATG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Irina M Shapiro et al.
Science translational medicine, 6(237), 237ra68-237ra68 (2014-05-23)
The goal of targeted therapy is to match a selective drug with a genetic lesion that predicts for drug sensitivity. In a diverse panel of cancer cell lines, we found that the cells most sensitive to focal adhesion kinase (FAK)
Juan Pablo Macagno et al.
PLoS genetics, 10(3), e1004262-e1004262 (2014-03-29)
Receptor Tyrosine Kinases (RTKs) and Focal Adhesion Kinase (FAK) regulate multiple signalling pathways, including mitogen-activated protein (MAP) kinase pathway. FAK interacts with several RTKs but little is known about how FAK regulates their downstream signalling. Here we investigated how FAK
Qi Cao et al.
Oncotarget, 7(47), 77468-77481 (2016-10-21)
To investigate the effects of microRNA-7 (miR-7) on the proliferation, migration and invasion of non-small cell lung cancer NSCLC) cells by targeting FAK through ERK/MAPK signaling pathway. NSCLC tissues and adjacent normal tissues were obtained from 160 NSCLC patients after
Frank Aboubakar Nana et al.
Molecular cancer therapeutics, 18(1), 17-27 (2018-10-26)
Small cell lung cancer (SCLC) has a poor prognosis. Focal adhesion kinase (FAK) is a non-receptor tyrosine kinase regulating cell proliferation, survival, migration, and invasion, which is overexpressed and/or activated in several cancers, including SCLC. We wanted to determine whether
Zhaokang Cheng et al.
The Journal of biological chemistry, 292(6), 2065-2079 (2016-12-21)
Autophagy is an evolutionarily conserved intracellular degradation/recycling system that is essential for cellular homeostasis but is dysregulated in a number of diseases, including myocardial hypertrophy. Although it is clear that limiting or accelerating autophagic flux can result in pathological cardiac

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique