Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU076051

Sigma-Aldrich

MISSION® esiRNA

targeting human NOX1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCACAACCTCACCTTCCACAAGCTGGTGGCCTATATGATCTGCCTACATACAGCTATTCACATCATTGCACACCTGTTTAACTTTGACTGCTATAGCAGAAGCCGACAGGCCACAGATGGCTCCCTTGCCTCCATTCTCTCCAGCCTATCTCATGATGAGAAAAAGGGGGGTTCTTGGCTAAATCCCATCCAGTCCCGAAACACGACAGTGGAGTATGTGACATTCACCAGCATTGCTGGTCTCACTGGAGTGATCATGACAATAGCCTTGATTCTCATGGTAACTTCAGCTACTGAGTTCATCCGGAGGAGTTATTTTGAAGTCTTCTGGTATACTCACCACCTTTTTATCTTCTATATCCTTGGCTTAGGGATTCACGGCATTGGTGGAATTGTCCGGGGTCAAACAGAGGAGAGCATGAATGAGAGTCATCCTCGCAAGTGTG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Gerco den Hartog et al.
PLoS pathogens, 12(1), e1005382-e1005382 (2016-01-14)
Generation of reactive oxygen species (ROS) during infection is an immediate host defense leading to microbial killing. APE1 is a multifunctional protein induced by ROS and after induction, protects against ROS-mediated DNA damage. Rac1 and NAPDH oxidase (Nox1) are important
Jin-Woo Jeong et al.
International journal of molecular sciences, 20(6) (2019-03-25)
Excessive bone resorption by osteoclasts causes bone loss-related diseases and reactive oxygen species (ROS) act as second messengers in intercellular signaling pathways during osteoclast differentiation. In this study, we explored the protective effects of fermented oyster extract (FO) against receptor
H-P Wang et al.
European review for medical and pharmacological sciences, 20(21), 4474-4481 (2016-11-23)
Reactive oxygen species (ROS) generated by endogenous metabolic enzymes are involved in a variety of pathology processes, including cancer. In particular, superoxide-generating NADPH oxidase 1 (Nox1), a member of Nox enzyme family, is highly expressed in the colon tissue and
The nuclear receptor NOR-1 modulates redox homeostasis in human vascular smooth muscle cells.
Judith Alonso et al.
Journal of molecular and cellular cardiology, 122, 23-33 (2018-08-11)
Mathieu Chocry et al.
Oncotarget, 8(61), 103710-103730 (2017-12-22)
Oxaliplatin is a major treatment for metastatic colorectal cancer, however its effectiveness is greatly diminished by the development of resistances. Our previous work has shown that oxaliplatin efficacy depends on the reactive oxygen species (ROS) produced by Nox1. In this

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique