Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU075291

Sigma-Aldrich

MISSION® esiRNA

targeting human VPS35

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGTGAAGATGGACCTGGAATCCCAGCGGATATTAAACTTTTTGATATATTTTCACAGCAGGTGGCTACAGTGATACAGTCTAGACAAGACATGCCTTCAGAGGATGTTGTATCTTTACAAGTCTCTCTGATTAATCTTGCCATGAAATGTTACCCTGATCGTGTGGACTATGTTGATAAAGTTCTAGAAACAACAGTGGAGATATTCAATAAGCTCAACCTTGAACATATTGCTACCAGTAGTGCAGTTTCAAAGGAACTCACCAGACTTTTGAAAATACCAGTTGACACTTACAACAATATTTTAACAGTCTTGAAATTAAAACATTTTCACCCACTCTTTGAGTACTTTGACTACGAGTCCAGAAAGAGCATGAGTTGTTATGTGCTTAGTAATGTTCTGGATTATAACACAGAAATTGTCTCTCAAGACCAGGTGGATTCCAT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Peiqi Yin et al.
Cellular and molecular life sciences : CMLS, 73(4), 869-881 (2015-08-25)
Hepatitis C virus (HCV) has infected over 170 million people worldwide. Phosphatidylinositol 4-phosphate (PI4P) is the organelle-specific phosphoinositide enriched at sites of HCV replication. Whether retromer, a PI4P-related host transport machinery, unloads its cargo at HCV replication sites remains inconclusive.
Amod Godbole et al.
Nature communications, 8(1), 443-443 (2017-09-07)
A new paradigm of G-protein-coupled receptor (GPCR) signaling at intracellular sites has recently emerged, but the underlying mechanisms and functional consequences are insufficiently understood. Here, we show that upon internalization in thyroid cells, endogenous TSH receptors traffic retrogradely to the
Guang Wang et al.
The Journal of cell biology, 218(12), 4030-4041 (2019-10-18)
The primary cilium is a sensory organelle that protrudes from the cell surface. Primary cilia undergo dynamic transitions between assembly and disassembly to exert their function in cell signaling. In this study, we identify the small GTPase Rab7 as a
Anna Ansell-Schultz et al.
Molecular and cellular neurosciences, 93, 18-26 (2018-09-27)
Alzheimer's disease (AD) is a neurodegenerative disorder characterized by a progressive loss of multiple cognitive functions. Accumulation of amyloid beta oligomers (oAβ) play a major role in the neurotoxicity associated with the disease process. One of the early affected brain
Prasad Tammineni et al.
Human molecular genetics, 26(22), 4352-4366 (2017-10-04)
Lysosomal proteolysis is essential for the quality control of intracellular components and the maintenance of cellular homeostasis. Lysosomal alterations have been implicated as one of the main cellular defects contributing to the onset and progression of Alzheimer's disease (AD). However

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique