Accéder au contenu
MilliporeSigma
Toutes les photos(2)

Principaux documents

EHU051011

Sigma-Aldrich

MISSION® esiRNA

targeting human PLK1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGCACCGAAACCGAGTTATTCATCGAGACCTCAAGCTGGGCAACCTTTTCCTGAATGAAGATCTGGAGGTGAAAATAGGGGATTTTGGACTGGCAACCAAAGTCGAATATGACGGGGAGAGGAAGAAGACCCTGTGTGGGACTCCTAATTACATAGCTCCCGAGGTGCTGAGCAAGAAAGGGCACAGTTTCGAGGTGGATGTGTGGTCCATTGGGTGTATCATGTATACCTTGTTAGTGGGCAAACCACCTTTTGAGACTTCTTGCCTAAAAGAGACCTACCTCCGGATCAAGAAGAATGAATACAGTATTCCCAAGCACATCAACCCCGTGGCCGCCTCCCTCATCCAGAAGATGCTTCAGACAGATCCCACTGCCCGCCCAACCATTAACGAGCTGCT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tomonori Higuchi et al.
Scientific reports, 7(1), 11026-11026 (2017-09-10)
The genetic events that lead to aggressive transformation of cases of splenic marginal zone lymphoma (SMZL) after the chronic clinical stage have not been well understood. We aimed to find candidate genes associated with aggressive features of SMZL. We have
Jinhua Dong et al.
Biotechnology and bioengineering, 117(5), 1259-1269 (2020-02-11)
Ultra Quenchbody (UQ-body) is a biosensor that utilizes the quenching behavior of the fluorescent dye linked to the antibody V region. When the corresponding antigen is bound to the UQ-body, the fluorescence is restored and allows the detection of target
Jenille Tan et al.
PloS one, 11(12), e0168968-e0168968 (2016-12-29)
To date, lentiviral-based CRISPR-Cas9 screens have largely been conducted in pooled format. However, numerous assays are not amenable to pooled approaches, and lentiviral screening in arrayed format presents many challenges. We sought to examine synthetic CRISPR reagents in the context
Xiao Peng Cai et al.
American journal of translational research, 8(10), 4172-4183 (2016-11-11)
Cancer cell epithelial-mesenchymal transition (EMT) is the crucial event for cancer progression and plays a vital role in the metastasis of cancer cells. Activation of Polo-like kinase 1 (PLK1) signaling has been implicated as the critical event in several tumor
Dongzhi Wang et al.
Anti-cancer agents in medicinal chemistry, 17(7), 948-954 (2016-09-28)
Recent investigations have implicated that Chitosan-nucleotide nanoparticles might be useful non-viral carriers in gene therapy. Polo-like kinase 1 (PLK1) has been reported to be an important oncogene that exerted considerable therapeutic merit in hepatocellular carcinoma (HCC). We explored whether Galactosylated

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique