Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU023531

Sigma-Aldrich

MISSION® esiRNA

targeting human RB1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGCATGGCTCTCAGATTCACCTTTATTTGATCTTATTAAACAATCAAAGGACCGAGAAGGACCAACTGATCACCTTGAATCTGCTTGTCCTCTTAATCTTCCTCTCCAGAATAATCACACTGCAGCAGATATGTATCTTTCTCCTGTAAGATCTCCAAAGAAAAAAGGTTCAACTACGCGTGTAAATTCTACTGCAAATGCAGAGACACAAGCAACCTCAGCCTTCCAGACCCAGAAGCCATTGAAATCTACCTCTCTTTCACTGTTTTATAAAAAAGTGTATCGGCTAGCCTATCTCCGGCTAAATACACTTTGTGAACGCCTTCTGTCTGAGCACCCAGAATTAGAACATATCATCTGGACCCTTTTCCAGCACACCCTGCAGAATGAGTATGAACTCATGAGAGACAGGCATTTGGACC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Toshiyuki Sumi et al.
Biochemical and biophysical research communications, 501(1), 253-258 (2018-05-05)
High expression levels of survivin in KRAS-mutant lung adenocarcinomas are linked with unfavorable patient outcomes, suggesting that survivin is a promising target for tumor treatment. We found that trametinib, a MEK inhibitor, downregulates survivin expression in the RB1-positive KRAS-mutant lung
Chun-Yu Liu et al.
PloS one, 12(12), e0189007-e0189007 (2017-12-21)
Triple negative breast cancer (TNBC) lacks specific drug targets and remains challenging. Palbociclib, a cyclin-dependent kinases 4 and 6 (CDK4/6) inhibitor is approved for metastatic estrogen receptor (ER)-positive and human epithermal growth factor 2 (HER2)-negative breast cancer. The nature of
Elisabetta Marangoni et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 24(11), 2605-2615 (2018-02-22)
Purpose: Triple-negative breast cancer (TNBC) patients with residual disease after neoadjuvant chemotherapy have a poor outcome. We developed patient-derived xenografts (PDX) from residual tumors to identify efficient chemotherapies and predictive biomarkers in a context of resistance to anthracyclines- and taxanes-based
Karen McColl et al.
Oncotarget, 8(43), 73745-73756 (2017-11-02)
The majority of small cell lung cancer (SCLC) patients demonstrate initial chemo-sensitivity, whereas a distinct subgroup of SCLC patients, termed chemo-refractory, do not respond to treatment. There is little understanding of how to distinguish these patients prior to disease treatment.
Hendrika A Segeren et al.
Cell reports, 33(9), 108449-108449 (2020-12-03)
E2F transcription factors control the expression of cell-cycle genes. Cancers often demonstrate enhanced E2F target gene expression, which can be explained by increased percentages of replicating cells. However, we demonstrate in human cancer biopsy specimens that individual neoplastic cells display

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique