Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU017941

Sigma-Aldrich

MISSION® esiRNA

targeting human FPR2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTTTTGGCTGGTTCCTGTGTAAGTTAATTCACATCGTGGTGGACATCAACCTCTTTGGAAGTGTCTTCTTGATTGGTTTCATTGCACTGGACCGCTGCATTTGTGTCCTGCATCCAGTCTGGGCCCAGAACCACCGCACTGTGAGTCTGGCCATGAAGGTGATCGTCGGACCTTGGATTCTTGCTCTAGTCCTTACCTTGCCAGTTTTCCTCTTTTTGACTACAGTAACTATTCCAAATGGGGACACATACTGTACTTTCAACTTTGCATCCTGGGGTGGCACCCCTGAGGAGAGGCTGAAGGTGGCCATTACCATGCTGACAGCCAGAGGGATTATCCGGTTTGTCATTGGCTTTAGCTTGCCGATGTCCATTGTTGCCATCTGCTATGGGCTCATTGCAGCCAAGATCCACAAAAAGGGCATGATTAAATCCAGCCGTCCCTTACGGGTCCTCACTGCTGTGGTGGCTTCTTTCTTCATCTGTTGGTTTCCCTTTCAACTGG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yi Xiang et al.
American journal of cancer research, 6(11), 2599-2610 (2016-12-03)
The G-protein coupled chemoattractant receptor formylpeptide receptor-2 (FPR2 in human, Fpr2 in mice) is expressed by mouse colon epithelial cells and plays a critical role in mediating mucosal homeostasis and inflammatory responses. However, the biological role of FPR2 in human
Liang Zong et al.
Journal of experimental & clinical cancer research : CR, 36(1), 181-181 (2017-12-13)
Pancreatic cancer is a lethal disease in part because of its potential for aggressive invasion and metastasis. Lipoxin A4 (LXA4) is one of the metabolites that is derived from arachidonic acid and that is catalyzed by 15-lipoxygenase (15-LOX), and it
Maayan Pereg et al.
PloS one, 14(6), e0217681-e0217681 (2019-06-07)
The ability to efficiently perform actions immediately following instructions and without prior practice has previously been termed Rapid Instructed Task Learning (RITL). In addition, it was found that instructions are so powerful that they can produce automatic effects, reflected in
Shixun Wang et al.
BioMed research international, 2016, 4819327-4819327 (2016-03-24)
Visfatin has been reported to exert an important role in the development of atherosclerosis. However, the mechanism that regulated the expression of Visfatin has not been elucidated yet. This study aimed to investigate the effect of SAA on the regulation
Mi-Sook Lee et al.
Cellular signalling, 27(7), 1439-1448 (2015-04-12)
Vascular endothelial growth factor-A (VEGF-A) is a master regulator of angiogenesis that controls several angiogenic processes in endothelial cells. However, the detailed mechanisms of VEGF-A responsible for pleiotropic functions and crosstalk with other signaling pathways have not been fully understood.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique