Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU007001

Sigma-Aldrich

MISSION® esiRNA

targeting human DSP

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGAAGTCGTTGTTGGCCACTATGAAGACAGAACTACAGAAAGCCCAGCAGATCCACTCTCAGACTTCACAGCAGTATCCACTTTATGATCTGGACTTGGGCAAGTTCGGTGAAAAAGTCACACAGCTGACAGACCGCTGGCAAAGGATAGATAAACAGATCGACTTTAGGTTATGGGACCTGGAGAAACAAATCAAGCAATTGAGGAATTATCGTGATAACTATCAGGCTTTCTGCAAGTGGCTCTATGATGCTAAACGCCGCCAGGATTCCTTAGAATCCATGAAATTTGGAGATTCCAACACAGTCATGCGGTTTTTGAATGAGCAGAAGAACTTGCACAGTGAAATATCTGGCAAACGAGACAAATCAGAGGAAGTACAAAAAATTGCTGAACTTTGCGCCAATTCAATTAAGGATTATGAGCTCCAGCTGGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Haiyong Wang et al.
Aging, 11(17), 6657-6673 (2019-09-05)
Long non-coding RNAs (lncRNAs) have been implicated in the pathogenesis of gastric cancer; however, their mechanisms of action remain largely unknown. The aim of this study was to identify lncRNAs involved in the tumorigenesis of gastric cancer and to investigate
Peipei Li et al.
International journal of biological sciences, 15(11), 2350-2362 (2019-10-09)
The interaction between genomic DNA and protein fundamentally determines the activity and the function of DNA elements. Capturing the protein complex and identifying the proteins associated with a specific DNA locus is difficult. Herein, we employed CRISPR, the well-known gene-targeting
Aritro Nath et al.
Molecular cancer research : MCR, 19(2), 240-248 (2020-10-28)
Elevated uptake of saturated fatty acid palmitate is associated with metastatic progression of cancer cells; however, the precise signaling mechanism behind the phenomenon is unclear. The loss of cell adhesion proteins, such as desmoplakin (DSP), is a key driving event
Dipal M Patel et al.
The Journal of cell biology, 206(6), 779-797 (2014-09-17)
Mechanisms by which microtubule plus ends interact with regions of cell-cell contact during tissue development and morphogenesis are not fully understood. We characterize a previously unreported interaction between the microtubule binding protein end-binding 1 (EB1) and the desmosomal protein desmoplakin
Johan Sternemalm et al.
PloS one, 10(8), e0134789-e0134789 (2015-08-05)
Deleterious mutations of the Centrosome/Spindle Pole associated Protein 1 gene, CSPP1, are causative for Joubert-syndrome and Joubert-related developmental disorders. These disorders are defined by a characteristic mal-development of the brain, but frequently involve renal and hepatic cyst formation. CSPP-L, the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique