Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU004681

Sigma-Aldrich

MISSION® esiRNA

targeting human KIF4A

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAATTGGCTTGGAAACGAAATTGAGGTTATGGTCAGTACTGAGGAAGCCAAACGCCATCTGAATGACCTCCTTGAAGATAGAAAGATCCTGGCTCAAGATGTGGCTCAACTCAAAGAAAAAAAGGAATCTGGGGAGAATCCACCTCCTAAACTCCGGAGGCGTACATTCTCCCTTACTGAAGTGCGTGGTCAAGTTTCGGAGTCAGAAGATTCTATTACAAAGCAGATTGAAAGCCTAGAGACTGAAATGGAATTCAGGAGTGCTCAGATTGCTGACCTACAGCAGAAGCTGCTGGATGCAGAAAGTGAAGACAGACCAAAACAACGCTGGGAGAATATTGCCACCATTCTGGAAGCCAAGTGTGCCCTGAAATATTTGATTGGAGAGCTGGTCTCCTCCAAAATACAGGTCAGCAAACTTGAAAGCAGCCTGAAACAGAGCAAGACCAGCTGTGCTGACATGCAGAAGATGCTGTTTGAGGAACGAAATCATTTTGCCGAGATAGAGACAGAGTTACAAGCTGAGCTGGTCAGAATGGAGCAACAGCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Junda Lin et al.
Medical oncology (Northwood, London, England), 34(1), 9-9 (2016-12-23)
Fucoidan is a complex of polysaccharides showing antitumor and immunomodulation properties. Our previous studies found its regulation to myeloid immune cells, including macrophages. Aberrant infiltration and functions of macrophages are commonly found in oral squamous cell carcinoma (OSCC). In this
Ping-Fu Hou et al.
Cell death & disease, 9(5), 477-477 (2018-05-01)
Kinesin family member 4A (KIF4A) was found to be implicated in the regulation of chromosome condensation and segregation during mitotic cell division, which is essential for eukaryotic cell proliferation. However, little is known about the role of KIF4A in colorectal
Guang-Hua Yang et al.
OncoTargets and therapy, 13, 2667-2676 (2020-04-14)
To evaluate the expression in human clear cell renal cell carcinoma (ccRCC) tissues and explore the effects of kinesin family member 4A (KIF4A) on ccRCC progression. GEPIA was used to evaluate the mRNA levels of KIF4A in human ccRCC tissues
Xiaozheng Sun et al.
Thoracic cancer, 12(4), 512-524 (2020-12-23)
In this study, we aimed to explore and clarify the function of KIF4A in esophageal squamous cell carcinoma (ESCC). The microarray data were extracted from the Gene Expression Omnibus (GEO) database. We then used the database for Annotation, Visualization, and
Elena Poser et al.
The Journal of cell biology, 219(2) (2019-12-28)
Aurora kinases create phosphorylation gradients within the spindle during prometaphase and anaphase, thereby locally regulating factors that promote spindle organization, chromosome condensation and movement, and cytokinesis. We show that one such factor is the kinesin KIF4A, which is present along

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique