Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EMU209401

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Dnm2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGCCCTTGAGAAGAGGCTATATCGGCGTGGTTAACCGAAGCCAGAAAGACATCGAGGGCAAAAAGGACATCCGGGCTGCTCTGGCAGCCGAGAGGAAATTCTTCCTCTCCCACCCAGCCTACCGGCACATGGCTGACCGCATGGGCACCCCACACTTGCAGAAAACCCTGAACCAGCAACTGACCAACCACATCCGAGAGTCACTGCCGACCCTTCGCAGCAAGCTGCAGAGCCAACTGCTGTCCCTGGAGAAGGAAGTGGAAGAGTACAAGAATTTCCGGCCTGATGACCCCACGCGCAAGACCAAAGCCCTGCTGCAGATGGTTCAGCAGTTTGGAGTGGACTTTGAGAAGCGAATTGAAGGCTCGGGAGATCAAGTAGACACACTAGAGTTGTCTGGTGGAGCCCGCATCAATCGTATCTTTCATGAGCGCTTTCCCTTTGAACTGGTAAAGATGGAGTTTGATGAGAAAGATCTACGAAGAGAGATCAGCTATGCTATTAAGAACATCCA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Kenji Tanabe et al.
The Journal of cell biology, 185(6), 939-948 (2009-06-17)
Dynamin is a fission protein that participates in endocytic vesicle formation. Although dynamin was originally identified as a microtubule-binding protein, the physiological relevance of this function was unclear. Recently, mutations in the ubiquitously expressed dynamin 2 (dyn2) protein were found
Anastasia Mashukova et al.
Molecular biology of the cell, 23(9), 1664-1674 (2012-03-09)
Phosphorylation of the activation domain of protein kinase C (PKC) isoforms is essential to start a conformational change that results in an active catalytic domain. This activation is necessary not only for newly synthesized molecules, but also for kinase molecules
Nah-Young Shin et al.
The Journal of cell biology, 207(1), 73-89 (2014-10-08)
Cell-cell fusion is an evolutionarily conserved process that leads to the formation of multinucleated myofibers, syncytiotrophoblasts and osteoclasts, allowing their respective functions. Although cell-cell fusion requires the presence of fusogenic membrane proteins and actin-dependent cytoskeletal reorganization, the precise machinery allowing

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service