Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU228771

Sigma-Aldrich

MISSION® esiRNA

targeting human USP17L2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGGATTTCAGACACTTTTGACCCTTACCTGGACATCGCCCTGGATATCCAGGCAGCTCAGAGTGTCAAGCAAGCTTTGGAACAGTTGGTGAAGCCCGAAGAACTCAATGGAGAGAATGCCTATCATTGCGGTCTTTGTCTCCAGAGGGCGCCGGCCTCCAAGACGTTAACTTTACACACTTCTGCCAAGGTCCTCATCCTTGTCTTGAAGAGATTCTCCGATGTCACAGGCAACAAACTTGCCAAGAATGTGCAATATCCTGAGTGCCTTGACATGCAGCCATACATGTCTCAGCAGAACACAGGACCTCTTGTCTATGTCCTCTATGCTGTGCTGGTCCACGCTGGGTGGAGTTGTCACGACGGACATTACTTCTCTTATGTCAAAGCTCAAGAAGGCCAGTGGTATAAAATGGATGATGCCAAGGTCACTGCCTGTAGCATCACTTCTGTCCTGAGTCAACAGGCCTATGTCCTCTTTTACATCCAGAAGAGTGAATGGGAAAGACACAGTGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Gabor Borbely et al.
Oncotarget, 6(32), 33623-33635 (2015-09-18)
Members of the bromodomain and extra-C terminal (BET) domain protein family and the histone deacetylase (HDAC) enzyme family regulate the expression of important oncogenes and tumor suppressor genes. Here we show that the BET inhibitor JQ1 inhibits proliferation and induces
Michelle de la Vega et al.
Nature communications, 2, 259-259 (2011-03-31)
Deubiquitinating enzymes are now emerging as potential therapeutic targets that control many cellular processes, but few have been demonstrated to control cell motility. Here, we show that ubiquitin-specific protease 17 (USP17) is rapidly and transiently induced in response to chemokines
M Mehić et al.
Oncogenesis, 6(6), e348-e348 (2017-06-13)
The levels of hyaluronan, a ubiquitous glycosaminoglycan prominent in the extracellular matrix, is balanced through the actions of hyaluronan-synthesizing enzymes (HAS1, 2 and 3) and degrading hyaluronidases (Hyal 1, 2, 3 and PH20). Hyaluronan accumulates in rapidly remodeling tissues, such
Tongzheng Liu et al.
Nature communications, 8, 13923-13923 (2017-01-10)
Tumour metastasis, the spread of cancer cells from the original tumour site followed by growth of secondary tumours at distant organs, is the primary cause of cancer-related deaths and remains poorly understood. Here we demonstrate that inhibition of CDK4/6 blocks

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service