Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU158011

Sigma-Aldrich

MISSION® esiRNA

targeting human ERMAP

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGAGACAAGACCAAATGGATTCTTGGAGTATGTAGTGAGTCAGTGAGCAGGAAGGGGAAGGTTACTGCCTCACCTGCCAATGGACACTGGCTTCTGCGACAGAGTCGTGGGAATGAGTATGAAGCTCTCACATCCCCGCAGACCTCCTTCCGCCTTAAAGAGCCTCCACGGTGTGTGGGGATTTTCCTGGACTATGAAGCAGGAGTCATCTCTTTCTACAATGTGACCAACAAGTCCCACATCTTTACTTTCACCCACAATTTCTCTGGCCCCCTTCGCCCTTTCTTTGAACCTTGCCTTCATGATGGAGGAAAAAACACAGCACCTCTAGTCATTTGTTCAGAACTACACAAATCAGAGGAATCAATTGTCCCCAGGCCAGAAGGGAAAGGCCATGCTAATGGAGA

Ensembl | human accession no.

ENSG00000164010

NCBI accession no.

NM_018538

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ERMAP(114625) , ERMAP(114625)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
KAS
EXR

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yong Shen et al.
Journal of cellular biochemistry, 119(1), 712-722 (2017-06-29)
Transcription factor TFII-I is a multifunctional protein implicated in the regulation of cell cycle and stress-response genes. Previous studies have shown that a subset of TFII-I associated genomic sites contained DNA-binding motifs for E2F family transcription factors. We analyzed the
Lilly Y W Bourguignon et al.
Matrix biology : journal of the International Society for Matrix Biology, 78-79, 180-200 (2018-08-06)
Head and neck squamous cell carcinoma (HNSCC) is a malignancy that often involves the oral cavity, pharynx, larynx, or paranasal sinuses. There is a compelling evidence of the human papilloma virus including HPV16 E6 oncogene drives cell transformation and oncogenic
Etienne Malvoisin et al.
Electrophoresis, 36(11-12), 1251-1255 (2015-01-30)
Based on their characteristics, we hypothesized that the following parameters, namely collagen IV, glutathione S-transferase, secretory component (SC), and AMP-activated protein kinase α1α2 may be useful serum markers in the detection of comorbidities in treated HIV-infected patients. These parameters were
Khaled Hached et al.
The Journal of cell biology, 218(2), 541-558 (2019-01-11)
Greatwall (GWL) is an essential kinase that indirectly controls PP2A-B55, the phosphatase counterbalancing cyclin B/CDK1 activity during mitosis. In Xenopus laevis egg extracts, GWL-mediated phosphorylation of overexpressed ARPP19 and ENSA turns them into potent PP2A-B55 inhibitors. It has been shown
Md Amran Howlader et al.
ACS chemical biology, 15(6), 1328-1339 (2020-04-21)
The human neuraminidase enzymes (NEU1, NEU2, NEU3, and NEU4) are a class of enzymes implicated in pathologies including cancer and diabetes. Several reports have linked neuraminidase activity to the regulation of cell migration in cancer cells. Using an in vitro
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service