Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU147491

Sigma-Aldrich

MISSION® esiRNA

targeting human EIF5A

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGAATGGCTTTGTGGTGCTCAAAGGCCGGCCATGTAAGATCGTCGAGATGTCTACTTCGAAGACTGGCAAGCACGGCCACGCCAAGGTCCATCTGGTTGGTATTGACATCTTTACTGGGAAGAAATATGAAGATATCTGCCCGTCAACTCATAATATGGATGTCCCCAACATCAAAAGGAATGACTTCCAGCTGATTGGCATCCAGGATGGGTACCTATCACTGCTCCAGGACAGCGGGGAGGTACGAGAGGACCTTCGTCTCCCTGAGGGAGACCTTGGCAAGGAGATTGAGCAGAAGTACGACTGTGGAGAAGAGATCCTGATCACGGTGCTGTCTGCCATGACAGAGGAGGCAGCTGTTGCAATCAAGGCCATGGCAAAATAACTGGCTCCCAGGGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Peixun Han et al.
Cell reports, 31(5), 107610-107610 (2020-05-07)
Ribosome movement is not always smooth and is rather often impeded. For ribosome pauses, fundamental issues remain to be addressed, including where ribosomes pause on mRNAs, what kind of RNA/amino acid sequence causes this pause, and the physiological significance of
Daniel J Puleston et al.
Cell metabolism, 30(2), 352-363 (2019-05-28)
How cells adapt metabolism to meet demands is an active area of interest across biology. Among a broad range of functions, the polyamine spermidine is needed to hypusinate the translation factor eukaryotic initiation factor 5A (eIF5A). We show here that
Hanlin Zhang et al.
Molecular cell, 76(1), 110-125 (2019-09-03)
Failure to make adaptive immune responses is a hallmark of aging. Reduced B cell function leads to poor vaccination efficacy and a high prevalence of infections in the elderly. Here we show that reduced autophagy is a central molecular mechanism

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service