Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU123061

Sigma-Aldrich

MISSION® esiRNA

targeting human AFDN

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTGGGCCTGAGCTGATACTACCTGCAAGCATTGAATTCAGGGAAAGTTCTGAAGATTCATTTTTGTCTGCCATTATAAATTATACTAATAGCTCTACAGTCCACTTTAAGTTGTCCCCTACATATGTATTATATATGGCATGCCGGTATGTATTGTCCAACCAGTACAGACCTGACATCAGCCCTACAGAGCGCACACATAAAGTCATTGCAGTCGTCAACAAGATGGTGAGCATGATGGAGGGTGTCATCCAGAAACAGAAGAATATTGCAGGGGCACTTGCCTTCTGGATGGCAAATGCATCTGAACTTCTCAACTTCATTAAGCAAGACCGAGACCTTAGTCGGATCACACTGGATGCTCAAGATGTTTTAGCACATTTGGTTCAAATGGCATTTAAATACTTGGTTCACTGTCTTCAATCAGAACTTAATAATTACATGCCAGCCTTTCTAGATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Paul Ugalde-Silva et al.
MicrobiologyOpen, 8(12), e931-e931 (2019-10-01)
Enteropathogenic Escherichia coli (EPEC) infection causes a histopathological lesion including recruitment of F-actin beneath the attached bacteria and formation of actin-rich pedestal-like structures. Another important target of EPEC is the tight junction (TJ), and EspF induces displacement of TJ proteins
Haruko Tsurumi et al.
Laboratory investigation; a journal of technical methods and pathology, 96(1), 49-59 (2015-11-17)
In kidney glomeruli, mesangial cells provide structural support to counteract for expansile forces caused by pressure gradients and to regulate the blood flow. Glomerular injury results in proliferation and aberrant migration of mesangial cells, which is the pathological characteristic of
Takuro Yamamoto et al.
BMC cancer, 15, 275-275 (2015-04-17)
AF-6/afadin plays an important role in the formation of adherence junctions. In breast and colon cancer, loss of AF-6/afadin induces cell migration and cell invasion. We aimed to elucidate the role of AF-6/afadin in human endometrial cancer. Morphology and AF-6/afadin

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service