Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU057101

Sigma-Aldrich

MISSION® esiRNA

targeting human PINK1, PINK1-AS

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGGAGTGTGAAACGCTCTGCCAGGCAGCCCTCCTCCTCTGCTCATGGAGGGCAGCCCTGTGATGTCCCTGCATGGAGCTGGTGAATTACTAAAAGAACATGGCATCCTCTGTGTCGTGATGGTCTGTGAATGGTGAGGGTGGGAGTCAGGAGACAAGACAGCGCAGAGAGGGCTGGTTAGCCGGAAAAGGCCTCGGGCTTGGCAAATGGAAGAACTTGAGTGAGAGTTCAGTCTGCAGTCCTCTGCTCACAGACATCTGAAAAGTGAATGGCCAAGCTGGTCTAGTAGATGAGGCTGGACTGAGGAGGGGTAGGCCTGCATCCACAGAGAGGATCCAGGCCAAGGCACTGGCTGTCAGTGGCAGAGTTTGGCTGTGACCTTTGCCCCTAACACGAGGAACTCGTTTGAAGGGGGCAGCGTAGCATGTCTGATTTGCCACCTGGAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

C-N Yang et al.
International endodontic journal, 52(5), 676-688 (2018-12-12)
To assess the connection between mitophagy and hypoxia-induced apoptosis in osteoblasts and whether simvastatin alleviates bone resorption in apical periodontitis through modulation of mitophagy-related apoptosis. Hypoxia-induced generation of reactive oxygen species in mitochondria and changes in mitochondrial membrane potential were
Yuan Xu et al.
Molecular neurobiology, 56(1), 252-266 (2018-04-25)
There is emerging evidence suggesting that neurotoxic insults and hypoxic/ischemic injury are underlying causes of Parkinson's disease (PD). Since PTEN-induced kinase 1 (PINK1) dysfunction is involved in the molecular genesis of PD and since our recent studies have demonstrated that
Yan Gao et al.
Biochemical pharmacology, 177, 113997-113997 (2020-05-01)
Alzheimer's disease (AD) is an irreversible neurodegenerative brain disorder with complex pathogenesis. The fibrillar peptide β-amyloid (Aβ) has a chief function in the pathogenesis of AD. Emerging evidence has indicated that there is a tight relationship between inflammation, mitochondrial dysfunction
Limin Wei et al.
International journal of nanomedicine, 12, 1891-1903 (2017-03-24)
With the increasing application of zinc oxide nanoparticles (ZnO NPs) in biological materials, the neurotoxicity caused by these particles has raised serious concerns. However, the underlying molecular mechanisms of the toxic effect of ZnO NPs on brain cells remain unclear.
Juan Liu et al.
Nature communications, 8(1), 1823-1823 (2017-11-29)
Mutations in E3 ubiquitin ligase Parkin have been linked to familial Parkinson's disease. Accumulating evidence suggests that Parkin is a tumor suppressor, but the underlying mechanism is poorly understood. Here we show that Parkin is an E3 ubiquitin ligase for

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service