Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU044461

Sigma-Aldrich

MISSION® esiRNA

targeting human UBR4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGCTTCTAGAACTGGCATCCACCACTAAGTGTAGCTCAGTGAAATATGATGTTGAAATAGTAGAGGAATACTTCGCTCGACAGATCTCATCCTTCTGTAGTATCGACTGTACCACCATCTTGCAGCTGCATGAAATTCCCAGTCTGCAGTCCATCTACACCCTTGATGCCGCGATCTCAAAGGTCCAGGTCTCTTTGGATGAGCATTTTTCTAAGATGGCTGCTGAGACTGATCCTCATAAGTCGTCTGAGATTACCAAGAACCTACTTCCAGCCACGCTGCAACTCATTGACACCTATGCATCGTTCACCAGAGCCTATTTGCTGCAAAACTTTAATGAAGAGGGAACAACTGAGAAACCTTCCAAGGAGAAACTGCAAGGCTTTGCTGCTGTTTTGGCTATTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Harrod H Ling et al.
PloS one, 9(8), e103103-e103103 (2014-08-02)
Circadian rhythms of behavior and physiology are driven by the biological clock that operates endogenously but can also be entrained to the light-dark cycle of the environment. In mammals, the master circadian pacemaker is located in the suprachiasmatic nucleus (SCN)
Liam C Hunt et al.
Cell reports, 28(5), 1268-1281 (2019-08-01)
Skeletal muscle cell (myofiber) atrophy is a detrimental component of aging and cancer that primarily results from muscle protein degradation via the proteasome and ubiquitin ligases. Transcriptional upregulation of some ubiquitin ligases contributes to myofiber atrophy, but little is known
Sung Tae Kim et al.
Journal of cell science, 131(17) (2018-08-17)
The N-end rule pathway is a proteolytic system in which single N-terminal residues of proteins act as N-degrons. These degrons are recognized by N-recognins, facilitating substrate degradation via the ubiquitin (Ub) proteasome system (UPS) or autophagy. We have previously identified
Sung Tae Kim et al.
PloS one, 13(8), e0202260-e0202260 (2018-08-30)
The N-end rule pathway is a proteolytic system in which single N-terminal amino acids of proteins act as a class of degrons (N-degrons) that determine the half-lives of proteins. We have previously identified a family of mammals N-recognins (termed UBR1

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service