Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU043091

Sigma-Aldrich

MISSION® esiRNA

targeting human ADM

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGCACACCAGATCTACCAGTTCACAGATAAGGACAAGGACAACGTCGCCCCCAGGAGCAAGATCAGCCCCCAGGGCTACGGCCGCCGGCGCCGGCGCTCCCTGCCCGAGGCCGGCCCGGGTCGGACTCTGGTGTCTTCTAAGCCACAAGCACACGGGGCTCCAGCCCCCCCGAGTGGAAGTGCTCCCCACTTTCTTTAGGATTTAGGCGCCCATGGTACAAGGAATAGTCGCGCAAGCATCCCGCTGGTGCCTCCCGGGACGAAGGACTTCCCGAGCGGTGTGGGGACCGGGCTCTGACAGCCCTGCGGAGACCCTGAGTCCGGGAGGCACCGTCCGGCGGCGAGCTCTGGCTTTGCAAGGGCCCCTCCTTCTGGGGGCTTCGCTTCCTTAGCCTTGCTCAGGTGCAAGTGCCCCAGGGGGCGGGGTGCAGAAGAATCCGAGTGTTTGCCAGGCTTAAGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ADM(133) , ADM(133)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shaojie Zhang et al.
Biochemical and biophysical research communications, 464(4), 1048-1053 (2015-07-22)
Bronchopulmonary dysplasia (BPD) is a chronic lung disease of premature infants that is characterized by alveolar simplification and decreased lung angiogenesis. Hyperoxia-induced oxidative stress and inflammation contributes to the development of BPD in premature infants. Adrenomedullin (AM) is an endogenous
Carole-Anne Whigham et al.
Pregnancy hypertension, 16, 16-25 (2019-05-06)
Preeclampsia is a pregnancy complication associated with elevated placental secretion of anti-angiogenic factors, maternal endothelial dysfunction and end-organ injury. Adrenomedullin (ADM) is a pro-angiogenic peptide hormone which regulates blood pressure and vascular integrity. It is highly expressed in both the
Lu Yao et al.
Archives of medical research, 50(1), 47-57 (2019-03-21)
Osteosarcoma is one of the most pernicious primary bone tumor characterized by high malignancy and metastasis, however its pathogenesis remain largely unknown. Our previous study showed elevated expression of adrenomedullin (ADM) is correlated with prognosis and disease severity in osteosarcoma
Tiechui Zhu et al.
Molecular medicine reports, 11(5), 3760-3766 (2015-01-15)
Renal tubular epithelial cells can enter the epithelial‑to‑mesenchymal transition (EMT) in response to chronic hypoxia. EMT is a process which involves the phenotypic conversion of epithelial cells, that is believed to have an important role in renal fibrosis. However, the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service