Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU035381

Sigma-Aldrich

MISSION® esiRNA

targeting human SGK1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCCTTCTCCTCCACCAAGTCCTTCTCAGCAAATCAACCTTGGCCCGTCGTCCAATCCTCATGCTAAACCATCTGACTTTCACTTCTTGAAAGTGATCGGAAAGGGCAGTTTTGGAAAGGTTCTTCTAGCAAGACACAAGGCAGAAGAAGTGTTCTATGCAGTCAAAGTTTTACAGAAGAAAGCAATCCTGAAAAAGAAAGAGGAGAAGCATATTATGTCGGAGCGGAATGTTCTGTTGAAGAATGTGAAGCACCCTTTCCTGGTGGGCCTTCACTTCTCTTTCCAGACTGCTGACAAATTGTACTTTGTCCTAGACTACATTAATGGTGGAGAGTTGTTCTACCATCTCCAGAGGGAACGCTGCTTCCTGGAACCACGGGCTCGTTTCTATGCTGCTGAAATAGCCAGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jing Jin et al.
Cell cycle (Georgetown, Tex.), 18(22), 3125-3136 (2019-10-01)
Jixuepaidu Tang-1 is obtained from the decoction of the Chinese traditional medicinal plants including Centella asiatica, Astragalus membranaceus, and Sanguis draconis. Transforming growth factor-β1 (TGF-β1)/serum- and glucocorticoid-inducible kinase-1 (SGK1)-induced epithelial-mesenchymal transition (EMT) plays a pivotal role in the pathogenesis of
Nadeshda Schelski et al.
Pflugers Archiv : European journal of physiology, 471(6), 889-899 (2019-02-02)
The serum- and glucocorticoid-inducible kinase 1 (SGK1) is a key regulator of osteo-/chondrogenic transdifferentiation and subsequent calcification of vascular smooth muscle cells (VSMCs). The phenotypical transdifferentiation of VSMCs is associated with increased interleukin-18 (IL-18) levels and generalized inflammation. Therefore, the
Eneda Toska et al.
Cell reports, 27(1), 294-306 (2019-04-04)
The PI3K pathway integrates extracellular stimuli to phosphorylate effectors such as AKT and serum-and-glucocorticoid-regulated kinase (SGK1). We have previously reported that the PI3K pathway regulates estrogen receptor (ER)-dependent transcription in breast cancer through the phosphorylation of the lysine methyltransferase KMT2D
Jakob Voelkl et al.
The Journal of clinical investigation, 128(7), 3024-3040 (2018-06-12)
Medial vascular calcification, associated with enhanced mortality in chronic kidney disease (CKD), is fostered by osteo-/chondrogenic transdifferentiation of vascular smooth muscle cells (VSMCs). Here, we describe that serum- and glucocorticoid-inducible kinase 1 (SGK1) was upregulated in VSMCs under calcifying conditions.
Takamitsu Miyayama et al.
Environmental toxicology and pharmacology, 38(2), 374-378 (2014-08-17)
In HK-2 cells exposed to cadmium chloride (CdCl2), the level of serum- and glucocorticoid-inducible kinase-1 (SGK1) protein is increased, but the levels of SGK2 and SGK3 proteins are not. Phosphorylation of SGK1 protein is also observed. Treatment with actinomycin D

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service