Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU034291

Sigma-Aldrich

MISSION® esiRNA

targeting human FOS

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGAATCCGAAGGGAAAGGAATAAGATGGCTGCAGCCAAATGCCGCAACCGGAGGAGGGAGCTGACTGATACACTCCAAGCGGAGACAGACCAACTAGAAGATGAGAAGTCTGCTTTGCAGACCGAGATTGCCAACCTGCTGAAGGAGAAGGAAAAACTAGAGTTCATCCTGGCAGCTCACCGACCTGCCTGCAAGATCCCTGATGACCTGGGCTTCCCAGAAGAGATGTCTGTGGCTTCCCTTGATCTGACTGGGGGCCTGCCAGAGGTTGCCACCCCGGAGTCTGAGGAGGCCTTCACCCTGCCTCTCCTCAATGACCCTGAGCCCAAGCCCTCAGTGGAACCTGTCAAGAGCATCAGCAGCATGGAGCTGAAGACCGAGCCCTTTGATGACTTCCTGTTCCCAGCATCAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Peipei Jin et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 83, 1212-1219 (2016-10-25)
Interleukin-1 receptor-associated kinase M (IRAK-M) is a well-known negative regulator for Toll-like receptor signaling, which can regulate immune homeostasis and tolerance in a number of pathological settings. However, the mechanism for IRAK-M regulation at transcriptional level remains largely unknown. In
Yahui Zhao et al.
The Journal of biological chemistry, 291(13), 6831-6842 (2016-02-10)
ID1 (inhibitor of differentiation/DNA binding 1) acts an important role in metastasis, tumorigenesis, and maintenance of cell viability. It has been shown that the up-regulation of ID1 is correlated with poor prognosis and the resistance to chemotherapy of human cancers.
Lianjie Hou et al.
Cells, 8(6) (2019-06-20)
Skeletal muscle plays an essential role in maintaining body energy homeostasis and body flexibility. Loss of muscle mass leads to slower wound healing and recovery from illness, physical disability, poor quality of life, and higher health care costs. So, it
Rui Bao et al.
American journal of translational research, 8(5), 2284-2292 (2016-06-28)
Forkhead/winged helix transcription factor p3 (Foxp3) increases in CD4(+)CD25(+)Treg cells during sepsis; however, related mechanisms are unclear. Our study aimed to explore the possible molecular mechanisms of high expression of Foxp3 in Treg cells during sepsis. Sepsis was induced by
Li Lin et al.
Journal of cellular physiology, 234(10), 18928-18941 (2019-04-21)
Pre-eclampsia (PE) is a serious hypertensive disorder of pregnancy that remains a leading cause of perinatal and maternal morbidity and mortality worldwide. Placental ischemia/hypoxia and the secretion of soluble fms-like tyrosine kinase 1 (sFlt1) into maternal circulation are involved in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service