Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU020571

Sigma-Aldrich

MISSION® esiRNA

targeting human KAT2B

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCCTAGCTGCTCATGTTTCCCACCTGGAGAATGTGTCAGAGGAAGAAATGAACAGACTCCTGGGAATAGTATTGGATGTGGAATATCTCTTTACCTGTGTCCACAAGGAAGAAGATGCAGATACCAAACAAGTTTATTTCTATCTATTTAAGCTCTTGAGAAAGTCTATTTTACAAAGAGGAAAACCTGTGGTTGAAGGCTCTTTGGAAAAGAAACCCCCATTTGAAAAACCTAGCATTGAACAGGGTGTGAATAACTTTGTGCAGTACAAATTTAGTCACCTGCCAGCAAAAGAAAGGCAAACAATAGTTGAGTTGGCAAAAATGTTCCTAAACCGCATCAACTATTGGCATCTGGAGGCACCATCTCAACGAAGACTGCGATCTCCCAATGATGATATTTCTGGATACAAAGAGAACTACACAAGGTGGCTGTGTTACTGCAACGTGCCACAGTTCTGCGACAGTCTACCTCGGTACGAAACCACACAGGTGTTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yu-Li Jia et al.
Cell death & disease, 7(10), e2400-e2400 (2016-10-07)
Aberrant autophagic processes have been found to have fundamental roles in the pathogenesis of different kinds of tumors, including hepatocellular carcinoma (HCC). P300/CBP-associated factor (PCAF), a histone acetyltransferase (HAT), performs its function by acetylating both histone and non-histone proteins. Our
Shiladitya Sengupta et al.
DNA repair, 66-67, 1-10 (2018-04-27)
Posttranslational modifications of DNA repair proteins have been linked to their function. However, it is not clear if posttranslational acetylation affects subcellular localization of these enzymes. Here, we show that the human DNA glycosylase NEIL1, which is involved in repair
Anna Perearnau et al.
Nucleic acids research, 45(9), 5086-5099 (2017-02-06)
The cyclin-dependent kinase inhibitor p27Kip1 (p27) also behaves as a transcriptional repressor. Data showing that the p300/CBP-associated factor (PCAF) acetylates p27 inducing its degradation suggested that PCAF and p27 could collaborate in the regulation of transcription. However, this possibility remained
S-M Jang et al.
Cell death & disease, 6, e1857-e1857 (2015-08-21)
Transcription factor SOX4 has been implicated in skeletal myoblast differentiation through the regulation of Cald1 gene expression; however, the detailed molecular mechanism underlying this process is largely unknown. Here, we demonstrate that SOX4 acetylation at lysine 95 by KAT5 (also
X Gai et al.
Cell death & disease, 6, e1712-e1712 (2015-04-10)
P300/CBP-associated factor (PCAF), a histone acetyltransferase (HAT), has been found to regulate numerous cell signaling pathways controlling cell fate by acetylating both histone and non-histone proteins. We previously reported that PCAF upregulates cell apoptosis by inactivating Serine/Threonine Protein Kinase 1

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service