All Photos(1)

Key Documents

View All Documentation

EHU016751

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human CTGF

Sign Into View Organizational & Contract Pricing

All Photos(1)

About This Item

UNSPSC Code:

41105324

NACRES:

NA.51

description

Quality Level

100

product line

MISSION^®

form

lyophilized powder

esiRNA cDNA target sequence

CTGCACCAGCATGAAGACATACCGAGCTAAATTCTGTGGAGTATGTACCGACGGCCGATGCTGCACCCCCCACAGAACCACCACCCTGCCGGTGGAGTTCAAGTGCCCTGACGGCGAGGTCATGAAGAAGAACATGATGTTCATCAAGACCTGTGCCTGCCATTACAACTGTCCCGGAGACAATGACATCTTTGAATCGCTGTACTACAGGAAGATGTACGGAGACATGGCATGAAGCCAGAGAGTGAGAGACATTAACTCATTAGACTGGAACTTGAACTGATTCACATCTCATTTTTCCGTAAAAATGATTTCAGTAGCACAAGTTATTTAAATCTGTTTTTCTAACTGGGGGAAAAGATTCCCACCCAATTCAAAACATTGTGCCATGTCAAACAAATAGTCTATCAACCCCAGACACTGGTTTGAAGAATGTTAAGACTTGACAGTGGAACTACATTAGTACACAGCACCAGAATGTATATTAAGGTGTGGCTTTAGGAGCA

Ensembl | human accession no.

ENSG00000118523

NCBI accession no.

NM_001901

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CTGF(1490) , CTGF(1490)

Related Categories

MISSION® esiRNA

Oligos, qPCR Probes & Peptides

General description

MISSION^® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Long Noncoding RNA H19 Acts as a Competing Endogenous RNA to Mediate CTGF Expression by Sponging miR-455 in Cardiac Fibrosis.

Zhi-Wen Huang et al.

DNA and cell biology, 36(9), 759-766 (2017-07-29)

Cardiac fibrosis is closely related to multiple cardiovascular system diseases, and noncoding RNAs (ncRNAs), including long noncoding RNA (lncRNA) and microRNA (miRNA), have been reported to play a vital role in fibrogenesis. The present study aims to investigate the potential

Loss of expression of protein phosphatase magnesium-dependent 1A during kidney injury promotes fibrotic maladaptive repair.

Rohan Samarakoon et al.

FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 30(10), 3308-3320 (2016-06-23)

Protein phosphatase magnesium-dependent-1A (PPM1A) dephosphorylates SMAD2/3, which suppresses TGF-β signaling in keratinocytes and during Xenopus development; however, potential involvement of PPM1A in chronic kidney disease is unknown. PPM1A expression was dramatically decreased in the tubulointerstitium in obstructive and aristolochic acid

PTEN Regulates Renal Extracellular Matrix Deposit via Increased CTGF in Diabetes Mellitus.

Lin Zhu et al.

Journal of cellular biochemistry, 117(5), 1187-1198 (2015-10-09)

Extracellular matrix accumulation and fibrosis are the features of diabetic nephropathy. PI3K (phosphatidylinositol 3-kinase)/Akt (protein kinase B) signal pathway and its inhibitor PTEN (phosphatase and tensin homolog deleted on chromosome 10) are revealed to modulate renal fibrosis. However, the exact

Connective tissue growth factor promotes temozolomide resistance in glioblastoma through TGF-β1-dependent activation of Smad/ERK signaling.

Huijun Zeng et al.

Cell death & disease, 8(6), e2885-e2885 (2017-06-16)

Limited benefits and clinical utility of temozolomide (TMZ) for glioblastoma (GB) are frequently compromised by the development of acquired drug resistance. Overcoming TMZ resistance and uncovering the underlying mechanisms are challenges faced during GB chemotherapy. In this study, we reported

Connective tissue growth factor dependent collagen gene expression induced by MAS agonist AR234960 in human cardiac fibroblasts.

Arunachal Chatterjee et al.

PloS one, 12(12), e0190217-e0190217 (2017-12-30)

Perspectives on whether the functions of MAS, a G protein-coupled receptor, are beneficial or deleterious in the heart remain controversial. MAS gene knockout reduces coronary vasodilatation leading to ischemic injury. G protein signaling activated by MAS has been implicated in

View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service