Skip to Content
Merck
All Photos(1)

Key Documents

EMU150591

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gulo

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATCTCCACGAGCCATACATAAACTACAATCATCTCAGGAAAAGGGGTTCCCCTTGCATCATATCTGTCCAGGCTAAGGATTTGGTCCTTCTAGGTTCTACTGGTCCACCAAGTATAGAGAGATCCCTGGGGCCTGCAGTTTTCCCTCCCTCTTCAGAAGGGATCTCTTGGCAACAGAGGTAGCATGAGGCATGCTCTGCTTACTTTTATCCTTAAAGGCCTTTCAGATGCCCAGAGTCTGTCTGTTGGTCCTGAGCAAGCCATCTTCCAGATGGGTCCACGTGGCCTTCTGACTGCCATGGCCTGGCCCTCACAGTGTCTCTTTCGGGTGGTGTTTAGAGTGGAATTTGCCTCGTCTTCTTAACCAGTTCCTGTTAGATCCCTGTGTTTTCTCCCTTCACCTCAGAGACAATTCTTTGGGCTGGGATCTCGCCGTGTCCCTGGGTTTCCCTGGGTCTTGGTTTCATCTTTCTCTTCACAGAGATGATTTCAGTTTATTTGTGGCCTTTCTGGAATGT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Anke Nijhuis et al.
Clinical science (London, England : 1979), 127(5), 341-350 (2014-03-20)
Intestinal fibrosis with stricture formation is a complication of CD (Crohn's disease) that may mandate surgical resection. Accurate biomarkers that reflect the relative contribution of fibrosis to an individual stricture are an unmet need in managing patients with CD. The
Quentin Lepiller et al.
Journal of innate immunity, 7(5), 530-544 (2015-03-21)
In patients with hepatitis C virus (HCV) infection, enhanced activity of indoleamine-2,3-dioxygenase 1 (IDO) has been reported. IDO - a tryptophan-catabolizing enzyme - has been considered as both an innate defence mechanism and an important regulator of the immune response.
Norbert Braun et al.
Scientific reports, 5, 13450-13450 (2015-08-26)
Tumor cells can adapt to a hostile environment with reduced oxygen supply. The present study aimed to identify mechanisms that confer hypoxia resistance. Partially hypoxia/reoxygenation (H/R)-resistant proximal tubular (PT) cells were selected by exposing PT cultures to repetitive cycles of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service