Skip to Content
Merck
All Photos(1)

Key Documents

EMU080021

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ticam1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCATTCTCATCAGGGTTCCCTGCAGCCACCTTCAGCATCCCCTGCAGTGACCAGAAGCCAGCCTCGTCCCATTGACACACCAGACTGGAGTTGGGGACATACGTTACACTCCACCAACAGCACTGCCTCACTGGCCAGCCACCTAGAGATCAGCCAGTCACCCACTCTTGCCTTTCTCTCTTCACACCATGGAACCCATGGGCCCAGCAAGCTATGTAACACACCGCTGGACACTCAGGAGCCTCAGCTTGTCCCTGAAGGCTGCCAAGAACCTGAGGAGATAAGCTGGCCTCCATCAGTGGAGACCAGTGTCTCCTTAGGGTTACCACACGAAATTAGCGTTCCAGAGGTGTCTCCAGAGGAGGCTTCGCCCATCCTCCCTGACGCCCTGGCTGCTCCAGACACAAGTGTCCACTGTCCCATTGAATGCACAGAGTTGTCTACAAACTCCAGGTCTCCCCT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yukinori Endo et al.
PloS one, 9(5), e98517-e98517 (2014-05-30)
Prostaglandin E2 (PGE2) is induced in vivo by bacterial products including TLR agonists. To determine whether PGE2 is induced directly or via IL-1β, human monocytes and macrophages were cultured with LPS or with Pam3CSK4 in presence of caspase-1 inhibitor, ZVAD
Faezzah Baharom et al.
Journal of immunology (Baltimore, Md. : 1950), 194(9), 4422-4430 (2015-03-25)
The proinflammatory microenvironment in the respiratory airway induces maturation of both resident and infiltrating dendritic cells (DCs) upon influenza A virus (IAV) infection. This results in upregulation of antiviral pathways as well as modulation of endocytic processes, which affect the
Suel-Gie Lee et al.
International journal of biological macromolecules, 79, 971-982 (2015-06-21)
The objective of this study was to investigate the immunostimulatory effects of a polysaccharide fraction from the leaves of Diospyros kaki Thumb (PLE0) and the molecular mechanism responsible for its action in RAW 264.7 macrophages as well as in vivo

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service