Skip to Content
Merck
All Photos(1)

Key Documents

EMU028701

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Dram1

Sign Into View Organizational & Contract Pricing

Select a Size


Select a Size

Change View

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGATTGCCTGTGCTTCACTCATTTCTATAACCAAGCTGGAATGGAATCCAAAAGAAAAGGATTATATATATCACGTGGTGAGCGCCATCTGTGAGTGGACCGTGGCTTTTGGTTTTATTTTCTATTTCCTAACATTCATCCAAGATTTCCAGAGTGTCACTCTAAGGATATCCACAGAAATCAATGACGACTTTTGAAAGATCGAGAATCCTGTCTCATTCAGGGAGTGTCGCAGACAGTTTCTGGAAGTGGACAGAGGACGGACGGGCTTGGATGTCACCCTGATGGGGACTTTATCTGTGGCACATCCGGGACTTGAATTTCATTAAGAGTTCCTAGTAGTTCAATTTACAAAGGTATGTTTCCCTGGAGGATGGATAGCACCAACGACACTGTAGCAATATTTTTATATTTTCTAAAACAATCTTTTATGAACAAATTCATATGCAAAGAAGACGAGGCAT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

K Liu et al.
Cell death & disease, 5, e1323-e1323 (2014-07-18)
Apoptosis-stimulating protein of p53-2 (ASPP2) induces apoptosis by promoting the expression of pro-apoptotic genes via binding to p53 or p73; however, the exact mechanisms by which ASPP2 induces apoptotic death in hepatoma cells are still unclear. Here, we show that
Brandon J Metge et al.
Scientific reports, 5, 11995-11995 (2015-07-07)
We have previously reported that expression of NMI (N-myc and STAT interactor) is compromised in invasive breast cancers. We also demonstrated that loss of NMI expression promotes epithelial-mesenchymal-transition and results in enhanced invasive ability of breast cancer cells. Additionally we

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service