Skip to Content
Merck
All Photos(1)

Key Documents

EHU151901

Sigma-Aldrich

MISSION® esiRNA

targeting human ZEB1

Sign Into View Organizational & Contract Pricing

Select a Size

100 μL
$829.00

$829.00


Please contact Customer Service for Availability


Select a Size

Change View
100 μL
$829.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$829.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATGGTGCAAGCTGTTGTTCTGCCAACAGTTGGTTTGGTGTCTCCCATAAGTATCAATTTAAGTGATATTCAGAATGTACTTAAAGTGGCGGTAGATGGTAATGTAATAAGGCAAGTGTTGGAGAATAATCAAGCCAATCTTGCATCCAAAGAACAAGAAACAATCAATGCTTCACCCATACAACAAGGTGGCCATTCTGTTATTTCAGCCATCAGTCTTCCTTTGGTTGATCAAGATGGAACAACCAAAATTATCATCAACTACAGTCTTGAGCAGCCTAGCCAACTTCAAGTTGTTCCTCAAAATTTAAAAAAAGAAAATCCAGTCGCTACAAACAGTTGTAAAAGTGAAAAGTTACCAGAAGATCTTACTGTTAAGTCTGAGAAGGACAAAAGCTTTGAAGGGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
HPA040947HPA040436HPA040407
antibody form

affinity isolated antibody

antibody form

affinity isolated antibody

antibody form

affinity isolated antibody

antibody form

affinity isolated antibody

Quality Level

100

Quality Level

100

Quality Level

100

Quality Level

100

biological source

rabbit

biological source

rabbit

biological source

rabbit

biological source

rabbit

product line

Prestige Antibodies® Powered by Atlas Antibodies

product line

Prestige Antibodies® Powered by Atlas Antibodies

product line

Prestige Antibodies® Powered by Atlas Antibodies

product line

Prestige Antibodies® Powered by Atlas Antibodies

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jin Xu et al.
Oncology letters, 14(2), 2483-2490 (2017-08-07)
Numerous studies have demonstrated that microRNAs (miRs) are involved in several physiological and pathological processes, and participate in cancer initiation and progression. The abnormal expression of miR-150 has been reported in numerous types of human cancer. However, at present there
Xiao-Jing Chen et al.
Cell death & disease, 10(7), 508-508 (2019-07-03)
The accumulation of tumour-associated macrophages (TAMs) in the hypoxic tumour microenvironment (TME) is associated with malignant progression in cancer. However, the mechanisms by which the hypoxic TME facilitates TAM infiltration are not fully understood. This study showed that high ZEB1
Ying Jiang et al.
OncoTargets and therapy, 12, 6093-6104 (2019-08-24)
Objective: Gastric cancer (GC) is a common tumor malignancy with high incidence and poor prognosis. Radiotherapy is one of the main strategies for GC treatment, while development of radioresistance limits the effectiveness. microRNA-203 (miR-203) has been reported to participate in
Y-G Zhang et al.
European review for medical and pharmacological sciences, 22(9), 2662-2670 (2018-05-18)
To explore the expression of extracellular vesicle-derived lncZEB1-AS1 in esophageal cancer and its role in esophageal cancer progression. The extracellular vesicles (EVs) from esophageal cancer patients (n = 26) and normal subjects (n = 26) were isolated by differential centrifugation.
Qiongyan Zou et al.
Journal of cellular biochemistry, 119(2), 2189-2199 (2017-09-01)
Breast cancer (BC) is one of the leading causes of cancer deaths worldwide and the most common cancer among women. In our previous study, we revealed that lncRNA TP73-AS1 promotes breast cancer cell proliferation through directly binding to miR-200a. Herein

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service