Skip to Content
Merck
All Photos(1)

Key Documents

EHU145401

Sigma-Aldrich

MISSION® esiRNA

targeting human PGAM5

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGGAGGAGGACAGTTACGAGATCTTCATCTGTCACGCCAACGTCATCCGCTACATCGTGTGCAGCATCCCGCCGCTGTTGTCCGCTGGGGATTTTGTGCTTCTGGGGTCCTGACCTCTTTCACTTGCTGATCTGTGGGCGCTCCCACCCGTGTGCCAGCGTGACGGCTCGGGGTGTCCGCTCCCCTCTGGGTCGAGGCCACAGCTGAGTCACGTTGCTGCTCGGGCTGCTCCCTCGGGGGGCCCTTGTCCCTCAACCTGCTCTGGTGCCCCACTCTCAGCACCACAGAATGATCCGGGTTCAGGTTGCGTTTTCCCTGCCACCACCCTGCAATCAGCCACTTCTTTAAGGAGCTCCAGGGCTGCAGCCACGTTAGAGGGCCCCTTGGGGGGCAGGGCCAGCTCTACGGTTACATGCCTGAAACAGTCAGAAGGGTTGGCCAAATCTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jeong-Min Hong et al.
Life sciences, 200, 94-104 (2018-03-11)
Heme oxygenase-1 (HO-1), an endogenous cytoprotective enzyme, is reported that can be localized in mitochondria under stress, contributing to preserve mitochondrial function. Mitochondrial quality control (QC) is essential to cellular health and recovery linked with redox homeostasis. Recent studies reported
Yuhua Chen et al.
Antioxidants & redox signaling, 34(2), 154-170 (2020-04-08)
Aims: Traumatic brain injury (TBI) is a major cause of disability and death, and a better understanding of the underlying mechanisms of mitochondrial dysfunction will provide important targets for preventing damage from neuronal insults. Phosphoglycerate mutase 5 (PGAM5) is localized
Chen Yang et al.
In vitro cellular & developmental biology. Animal, 53(3), 248-257 (2016-11-07)
Phosphoglycerate mutase 5 (PGAM5) is a mitochondrial membrane protein that plays crucial roles in necroptosis and apoptosis. Though PGAM5 is known to be required for inducing intrinsic apoptosis through interacting with BCL2 associated X protein (Bax) and dynamin-related protein 1
Wei Zuo et al.
European journal of pharmacology, 880, 173143-173143 (2020-05-04)
Growing evidence have suggested that mitophagy could exert a neuroprotective role in brain ischemia by removing the damaged mitochondria. However the upstream mechanisms of mitophagy are remain unclear. We previously observed a decrease of miR-330 in a miRNA profile of
Wei Lu et al.
Nature communications, 5, 4930-4930 (2014-09-16)
Mitophagy is a specialized form of autophagy that selectively disposes of dysfunctional mitochondria. Delineating the molecular regulation of mitophagy is of great importance because defects in this process lead to a variety of mitochondrial diseases. Here we report that mice

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service