Skip to Content
Merck
All Photos(1)

Key Documents

EHU130131

Sigma-Aldrich

MISSION® esiRNA

targeting human CD83

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGGCCCTATTCCCTGAAGATCCGAAACACTACCAGCTGCAACTCGGGGACATACAGGTGCACTCTGCAGGACCCGGATGGGCAGAGAAACCTAAGTGGCAAGGTGATCTTGAGAGTGACAGGATGCCCTGCACAGCGTAAAGAAGAGACTTTTAAGAAATACAGAGCGGAGATTGTCCTGCTGCTGGCTCTGGTTATTTTCTACTTAACACTCATCATTTTCACTTGTAAGTTTGCACGGCTACAGAGTATCTTCCCAGATTTTTCTAAAGCTGGCATGGAACGAGCTTTTCTCCCAGTTACCTCCCCAAATAAGCATTTAGGGCTAGTGACTCCTCACAAGACAGAACTGGTATGAGCAGGATTTCTGCAGGTTCTTCTTCCTGAAGCTGAGGCTCAGGGGTGTGCCTGTCTGTTACACTGGAGGAGAGAAGAATGAGCCTACGCTGAAGATGGCATCCTGTGAAGTCCTTCACCTCACTGAAAACATCTGGAAGGGGATCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

S M Shamsul Islam et al.
Mediators of inflammation, 2019, 5761392-5761392 (2019-10-05)
Behçet's disease (BD) is an autoinflammatory disease that can lead to life- and sight-threating complications. Dendritic cells (DCs) are the most potent antigen-presenting cells that can regulate multiple inflammatory pathways. The objective of this study was to investigate the association
Shanshan Huo et al.
Developmental and comparative immunology, 99, 103398-103398 (2019-05-24)
Emerging evidence suggests that CD83, a dendritic cells (DCs) maturation marker in humans and mice, may prossess immunomodulatory capacities. Although porcine CD83 shares ∼75% sequence homology with its human counterpart, whether it functions as an immunoregulatory molecule remains unknown. To

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service