Skip to Content
Merck
All Photos(1)

Key Documents

EHU093851

Sigma-Aldrich

MISSION® esiRNA

targeting human LPAR2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATGACTTGTGGGTGCTCCTGGCTCAACCCAACCAACAGGACTGACTGACTGGCAGGACAAGGTCTGGCATGGCACAGCACCACTGCCAGGCCTCCCCAGGCACACCACTCTGCCCAGGGAATGGGGGCTTTGGGTCATCTCCCACTGCCTGGGGGAGTCAGATGGGGTGCAGGAATCTGGCTCTTCAGCCATCTCAGGTTTAGGGGGTTTGTAACAGACATTATTCTGTTTTCACTGCGTATCCTTGGTAAGCCCTGTGGACTGGTTCCTGCTGTGTGATGCTGAGGGTTTTAAGGTGGGGAGAGATAAGGGCTCTCTCGGGCCATGCTACCCGGTATGACTGGGTAATGAGGACAGACTGTGGACACCCCATCTACCTGAGTCTGATTCTTTAGCAGCAGAGACTGAGGGGTGCAGAGTGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zi Wang et al.
Journal of molecular medicine (Berlin, Germany), 98(12), 1781-1794 (2020-11-01)
Autotaxin (ATX) is a secreted enzyme that hydrolyzes lysophosphatidylcholine (LPC) to lysophosphatidic acid (LPA) and choline. ATX has been implicated in multiple chronic inflammatory diseases, but little is known about its role in the development of inflammatory bowel disease (IBD).
Ying Zhang et al.
OncoTargets and therapy, 13, 4145-4155 (2020-06-12)
The dysregulation of the human papillomavirus 18 E6 and E7 oncogenes plays a critical role in the angiogenesis of cervical cancer (CC), including the proliferation, migration, and tube formation of vascular endothelial cells. Interfering E6/E7 increases the number of CC
Simon McArthur et al.
Journal of immunology (Baltimore, Md. : 1950), 195(3), 1139-1151 (2015-06-24)
Blood-derived monocytes remove apoptotic cells and terminate inflammation in settings as diverse as atherosclerosis and Alzheimer's disease. They express high levels of the proresolving receptor ALX/FPR2, which is activated by the protein annexin A1 (ANXA1), found in high abundance in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service