Skip to Content
Merck
All Photos(1)

Key Documents

EHU050111

Sigma-Aldrich

MISSION® esiRNA

targeting human PBK

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGACCCTGAGGCTTGTTACATTGGCACAGAGCCATGGAAACCCAAAGAAGCTGTGGAGGAGAATGGTGTTATTACTGACAAGGCAGACATATTTGCCTTTGGCCTTACTTTGTGGGAAATGATGACTTTATCGATTCCACACATTAATCTTTCAAATGATGATGATGATGAAGATAAAACTTTTGATGAAAGTGATTTTGATGATGAAGCATACTATGCAGCGTTGGGAACTAGGCCACCTATTAATATGGAAGAACTGGATGAATCATACCAGAAAGTAATTGAACTCTTCTCTGTATGCACTAATGAAGACCCTAAAGATCGTCCTTCTGCTGCACACATTGTTGAAGCTCTGGAAACAGATGTCTAGTGATCATCTCAGCTGAAGTGTGGCTTGCGTAA

Ensembl | human accession no.

ENSG00000168078

NCBI accession no.

NM_018492

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PBK(55872) , PBK(55872)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
JUU
NRR
RPR

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jia-Hong Chen et al.
International journal of biological macromolecules, 81, 615-623 (2015-09-01)
Roles and mechanisms of cell cycle-specific transcription factor E2F1 on prostate cancer (PCa) have not been fully elucidated. To address this problem, we here identified PDZ-binding kinase (PBK) as a direct target for E2F1 through bioinformatics binding site prediction, combined
D Herrero-Martín et al.
British journal of cancer, 101(1), 80-90 (2009-06-06)
Ewing sarcoma is a paradigm of solid tumour -bearing chromosomal translocations resulting in fusion proteins that act as deregulated transcription factors. Ewing sarcoma translocations fuse the EWS gene with an ETS transcription factor, mainly FLI1. Most of the EWS-FLI1 target
Gen Wang et al.
Breast cancer research and treatment, 175(3), 567-578 (2019-04-03)
In early stage, ERα-positive breast cancer, concurrent use of endocrine therapy and chemotherapy has not been shown to be superior to sequential use. We hypothesized that genetic biomarkers can aid in selecting patients who would benefit from chemo-endocrine therapy. Our
Joshua D Brown-Clay et al.
Oncotarget, 6(17), 15594-15609 (2015-04-25)
A current challenge in prostate cancer treatment is how to differentiate aggressive disease from indolent prostate cancer. There is an urgent need to identify markers that would accurately distinguish indolent prostate cancer from aggressive disease. The aim of this study
Ziping Han et al.
Aging and disease, 9(2), 235-248 (2018-06-14)
T-LAK-cell-originated protein kinase (TOPK) is a newly identified member of the mitogen-activated protein kinase family. Our previous study has showed that TOPK has neuroprotective effects against cerebral ischemia-reperfusion injury. Here, we investigated the involvement of TOPK in microglia/ macrophage M1/M2
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service